Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 4 showing 61 ~ 80 out of 12,978 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_124443

http://www.addgene.org/124443

Species: Mus musculus
Genetic Insert: Biorientation of chromosomes in cell division 1-like
Vector Backbone Description: Backbone Marker:Thermo Scientific (CloneJET PCR Cloning Kit); Backbone Size:2974; Vector Backbone:pJET1.2/blunt; Vector Types:In situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31169497

Proper citation: RRID:Addgene_124443 Copy   

    • RRID:Addgene_124435

http://www.addgene.org/124435

Species: Mus musculus
Genetic Insert: PU.1 ETS domain (residues 167-272)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30295801

Proper citation: RRID:Addgene_124435 Copy   

    • RRID:Addgene_124437

http://www.addgene.org/124437

Species: Mus musculus
Genetic Insert: NK3 homeobox 2
Vector Backbone Description: Backbone Marker:Thermo Scientific (CloneJET PCR Cloning Kit); Backbone Size:2974; Vector Backbone:pJET1.2/blunt; Vector Types:In situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31169497

Proper citation: RRID:Addgene_124437 Copy   

http://www.addgene.org/124438

Species: Mus musculus
Genetic Insert: NK3 homeobox 2
Vector Backbone Description: Backbone Marker:Thermo Scientific (CloneJET PCR Cloning Kit); Backbone Size:2974; Vector Backbone:pJET1.2/blunt; Vector Types:In situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31169497

Proper citation: RRID:Addgene_124438 Copy   

    • RRID:Addgene_11206

    This resource has 1+ mentions.

http://www.addgene.org/11206

Species: Mus musculus
Genetic Insert: Nedd4-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12907674

Proper citation: RRID:Addgene_11206 Copy   

    • RRID:Addgene_112228

    This resource has 1+ mentions.

http://www.addgene.org/112228

Species: Mus musculus
Genetic Insert: (Arkadia)Rnf111
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx2-hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17341133
Comments: The GFP tagged Arkadia constructs were generated by eliminating the first 9 aa of Arkadia and fusing in frame to GFP Sequences and cloned into SmaI/XhoI of the pTriEx2-hygro (Novagen, http://www.novagen.com) vector.

Proper citation: RRID:Addgene_112228 Copy   

http://www.addgene.org/112229

Species: Mus musculus
Genetic Insert: (Arkadia)Rnf111
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx2-hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17341133
Comments: The GFP tagged Arkadia constructs were generated by eliminating the first 9 aa of Arkadia and fusing in frame to GFP Sequences and cloned into SmaI/XhoI of the pTriEx2-hygro (Novagen, http://www.novagen.com) vector.

Proper citation: RRID:Addgene_112229 Copy   

    • RRID:Addgene_112226

http://www.addgene.org/112226

Species: Mus musculus
Genetic Insert: MPND
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:pET30a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30982744

Proper citation: RRID:Addgene_112226 Copy   

http://www.addgene.org/112272

Species: Mus musculus
Genetic Insert: shRNA against mouse HDAC3
Vector Backbone Description: Vector Backbone:pRNATU6.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112272 Copy   

    • RRID:Addgene_112270

http://www.addgene.org/112270

Species: Mus musculus
Genetic Insert: protein kinase c gamma
Vector Backbone Description: Backbone Size:4718; Vector Backbone:mEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30013171

Proper citation: RRID:Addgene_112270 Copy   

http://www.addgene.org/112273

Species: Mus musculus
Genetic Insert: shRNA negative control
Vector Backbone Description: Vector Backbone:pRNATU6.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112273 Copy   

    • RRID:Addgene_112700

    This resource has 1+ mentions.

http://www.addgene.org/112700

Species: Mus musculus
Genetic Insert: Nuclear Factor I B2
Vector Backbone Description: Vector Backbone:pCAGG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112700 Copy   

    • RRID:Addgene_112703

http://www.addgene.org/112703

Species: Mus musculus
Genetic Insert: Nuclear Factor I B2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112703 Copy   

    • RRID:Addgene_112733

http://www.addgene.org/112733

Species: Mus musculus
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Feng Zhang; Backbone Size:4574; Vector Backbone:PX552; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29706865
Comments: gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang.

Proper citation: RRID:Addgene_112733 Copy   

    • RRID:Addgene_112711

    This resource has 1+ mentions.

http://www.addgene.org/112711

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication. Additional internal sequencing primers: IntCE1-F: GAATGCCCCACCACTGAGAATACTG IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC

Proper citation: RRID:Addgene_112711 Copy   

    • RRID:Addgene_112716

    This resource has 1+ mentions.

http://www.addgene.org/112716

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the guanylyltransferase domain of RNGTT.

Proper citation: RRID:Addgene_112716 Copy   

    • RRID:Addgene_112715

    This resource has 1+ mentions.

http://www.addgene.org/112715

Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the triphosphatase domain of RNGTT.

Proper citation: RRID:Addgene_112715 Copy   

    • RRID:Addgene_112704

http://www.addgene.org/112704

Species: Mus musculus
Genetic Insert: Nuclear Factor I X2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_112704 Copy   

http://www.addgene.org/112841

Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899

Proper citation: RRID:Addgene_112841 Copy   

http://www.addgene.org/112843

Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899

Proper citation: RRID:Addgene_112843 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch