Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNA3 PARL-FLAG-CT wild type
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13639 Presenilin-associated rhomboid-like Homo sapiens Ampicillin PMID:14732705 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:18 3
pcDNA3-CD14
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_13645 CD14 Homo sapiens Ampicillin This plasmid was cloned by cut and paste from pCEP4-HuCD14 with KpnI (5') and NotI (3'). Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 11
pLenti_TetOn_Hu_HEC1(WT)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136353 HEC1 Homo sapiens Ampicillin Vector Backbone:pLenti-CMVtight-Hygro-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-05 12:48:18 1
pcDNA3-TLR10-YFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13643 Toll-Like Receptor 10 Homo sapiens Ampicillin The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3' Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:18 2
pSIE1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136355 Type VI effector bfe1 Bacteroides fragilis 638R Ampicillin PMID:31712278 Backbone Size:2980; Vector Backbone:pExchange_tdk; Vector Types:Unspecified; Bacterial Resistance:Ampicillin ATG removed to add signal sequence before gene 2026-09-05 12:48:18 5
pDONR-U6gRNA-PGKpuro2APDGFB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136409 Kanamycin PMID:29654229 Vector Backbone:pDONR-U6gRNA-PGKpuro2ABFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin BbsI restriction site in the PDGFB sequence (Glu173Asp174) was removed by site directed mutagenesis 2026-09-05 12:48:18 1
pvimentin-emiRFP703
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136566 vimentin-emiRFP703 Homo sapiens Kanamycin PMID:31932632 Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-05 12:48:20 1
pH2B-emiRFP670
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136571 H2B-emiRFP670 Homo sapiens Kanamycin PMID:31932632 Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-05 12:48:20 3
pCEP4-myc-PDGFRbeta
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136455 PDGFRbeta Homo sapiens Ampicillin PMID:32559251 Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 1
pBABE_hygro_mRFP1_NRF2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136579 NRF2 Homo sapiens Ampicillin PMID:32291314 Backbone Marker:Addgene #1765; Backbone Size:5219; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-05 12:48:20 2
DHB-mVenus
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136461 DNA Helicase B Homo sapiens Ampicillin PMID:24075009 Backbone Size:9136; Vector Backbone:CSII-EF-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 6
pLifeAct-HyPer7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136464 HyPer7 Kanamycin PMID:32130885 Vector Backbone:-; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-05 12:48:19 1
pCS2+HyPer7-NES
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_136467 HyPer7 Ampicillin PMID:32130885 Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 17
pCS2+HyPer7-NLS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136468 HyPer7 Ampicillin PMID:32130885 Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 4
pRDA_052
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136474 Puromycin resistance Other Ampicillin PMID:32661438 Vector Backbone:pLKO; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 7
pRDA_112
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136475 AsCas12a Other Ampicillin PMID:32661438 Vector Backbone:pLKO; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 1
pRosetta_v2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136477 HygroR-T2A-BlastR-P2A-PuroR-F2A-EGFP Other Ampicillin PMID:32661438 Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 1
pEN_TTmiRC2_3xflag_Luciferase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136519 Luciferase Gentamicin PMID:32291314 Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-09-05 12:48:19 1
pEN_TTmiRC2_3xflag_NRF2(RR)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136522 NRF2(1584A>C,1586A>T,1589A>G) Homo sapiens Gentamicin PMID:32291314 Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin This plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa 2026-09-05 12:48:19 1
pSLIK_hygro_3xflag_Luciferase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_136528 Luciferase Firefly Ampicillin PMID:32291314 Backbone Marker:Addgene #25737; Backbone Size:13286; Vector Backbone:pSLIK-hygro; Vector Types:Mammalian Expression, Lentiviral, destinatioin vector for gateway cloning; Bacterial Resistance:Ampicillin 2026-09-05 12:48:19 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch