Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Systems Biosciences; Backbone Size:4700; Vector Backbone:Piggybac; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR, Synthetic Biology, Piggybac transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30093604
Proper citation: RRID:Addgene_104536 Copy
Species: Saccharomyces eubayanus
Genetic Insert: SeGAL2 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066
Proper citation: RRID:Addgene_104508 Copy
Species: HIV-1 virus
Genetic Insert: 2LTR circle junction of HIV-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3001; Vector Backbone:pGemT; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18762215
Comments: During HIV-1 infection, unintegrated viral cDNA may be circularized. The circularization generates a unique junction between the long terminal repeat (LTR) ends. HIV-1 2LTR circles have been quantified as measure of viral replication or entry of the viral cDNA into the host cell nucleus. The amplicon is 2672-2879 in the Addgene sequence file. This corresponds to HIV-1 strain HXB2 reference genome 9585-9719 bp (Addgene 2672-2806 bp) fused to 1 to 51 bp (Addgene 2829-2879 bp). In this plasmid there are 22 bp (Addgene 2807-2828 bp) of random sequence inserted between the HIV-1 ends. The insert may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), MH536 (5' TCCACAGATCAAGGATATCTTGTC), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT).
Proper citation: RRID:Addgene_104590 Copy
Species: Mus musculus
Genetic Insert: Mouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Proper citation: RRID:Addgene_104581 Copy
Species: Homo sapiens
Genetic Insert: Human IgG1 CH1/CH2/CH3
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Comments: Addgene NGS results found A169G, A261G, A292G, and A295G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1
Proper citation: RRID:Addgene_104583 Copy
Species: Saccharomyces kudriavzevii
Genetic Insert: SkGAL1 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066
Proper citation: RRID:Addgene_104504 Copy
Species: Saccharomyces mikatae
Genetic Insert: SmGAL2 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066
Proper citation: RRID:Addgene_104507 Copy
Species: Saccharomyces paradoxus
Genetic Insert: SpGAL1 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066
Proper citation: RRID:Addgene_104506 Copy
Species: Aequoria Victoria, Opsanus
Genetic Insert: Twitch-2C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440
Proper citation: RRID:Addgene_104501 Copy
Species: Mus musculus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297
Proper citation: RRID:Addgene_104589 Copy
Species: Synthetic
Genetic Insert: Streptococcus pyogenes Cas9
Vector Backbone Description: Backbone Marker:Addgene #60957; Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297
Proper citation: RRID:Addgene_104588 Copy
Species: Other
Genetic Insert: Gala7 promoter
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104516 Copy
Species: Other
Genetic Insert: Gateway cassette
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104518 Copy
Species: Other
Genetic Insert: hrpB promoter
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104514 Copy
Species: Saccharomyces uvarum
Genetic Insert: SuGAL2 promoter-yEGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301066
Proper citation: RRID:Addgene_104513 Copy
Species: Synthetic
Genetic Insert: CaCas9/sgCgADE2
Vector Backbone Description: Backbone Marker:RS Sikorski; Vector Backbone:pRS416; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29695624
Proper citation: RRID:Addgene_111438 Copy
Species: Synthetic
Genetic Insert: GCaMP6m-XC
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29666364
Proper citation: RRID:Addgene_111543 Copy
Species: Homo sapiens
Genetic Insert: thy1.2-Kv2.1-HA
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27798188
Proper citation: RRID:Addgene_111541 Copy
Species: Drosophila melanogaster
Genetic Insert: ChrimsonR_mCherry_trafficked
Vector Backbone Description: Vector Backbone:10XUAS IVS sv40; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633
Proper citation: RRID:Addgene_111547 Copy
Species: Drosophila melanogaster
Genetic Insert: CsChrimson_tdtomato_trafficked
Vector Backbone Description: Vector Backbone:5XUAS IVS sv40; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633
Proper citation: RRID:Addgene_111545 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
