Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 318 showing 6341 ~ 6360 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_38060

http://www.addgene.org/38060

Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15580589
Comments: Adenoviral plasmid for overexpression of EGFP from tetracycline responsive element (TRE), intended to be used in conjucntion with one of the plasmids expressing tet transactivator (tTA), such as Addgene plasmid #'s 38056, 38057, 38058 or 38059. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617

Proper citation: RRID:Addgene_38060 Copy   


  • RRID:Addgene_38047

http://www.addgene.org/38047

Species: Human adenovirus 5
Genetic Insert: E1B 19K
Vector Backbone Description: Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22810586
Comments: Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, adding several amino acid residues [STFLYKVVR] fused to the C-terminus of translated protein.

Proper citation: RRID:Addgene_38047 Copy   


  • RRID:Addgene_38041

http://www.addgene.org/38041

Vector Backbone Description: Backbone Marker:Masatoshi Takeichi; Backbone Size:4839; Vector Backbone:CA-MCS; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22681690

Proper citation: RRID:Addgene_38041 Copy   


  • RRID:Addgene_38044

    This resource has 10+ mentions.

http://www.addgene.org/38044

Species: Synthetic
Genetic Insert: Avian sarcoma and leukemia virus receptor 950
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22681690

Proper citation: RRID:Addgene_38044 Copy   


  • RRID:Addgene_38050

http://www.addgene.org/38050

Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15129168
Comments: Adenoviral plasmid for overexpression of CREB from CMV promoter

Proper citation: RRID:Addgene_38050 Copy   


  • RRID:Addgene_38159

http://www.addgene.org/38159

Species: Homo sapiens
Genetic Insert: BCR/ABL P190
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18070886
Comments: Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.75 kb BamHI/Sal I + 3' 6.3 kb Sal I/EcoRI BCR/ABL fragments into pLEF digested with BamHIxEcoRI. The ABL part of the insert contains the natural TAG and 3' UT sequences. Addgene NGS identified a sequence discrepancy at nucleotide 3168 resulting in a T117M mutation in the ABL-1 sequence, relative to Genbank ID NP_005148.2 and Addgene Plasmid #38158. This is not a known polymorphism and the effect of this, if any, on the protein is not known.

Proper citation: RRID:Addgene_38159 Copy   


http://www.addgene.org/38155

Species: Homo sapiens
Genetic Insert: Abr
Vector Backbone Description: Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17116687
Comments: Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I.

Proper citation: RRID:Addgene_38155 Copy   


  • RRID:Addgene_38157

http://www.addgene.org/38157

Species: Homo sapiens
Genetic Insert: ABR
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18070886
Comments: Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.4 kb BamHI/BstEII + 3' 2.2 kb BstEII/EcoRI ABR fragments into pLEF digested with BamHIxEcoRI. The ABR insert contains the natural TAG and 3' UT sequences. Addgene sequencing found an E24G point mutation--this does not alter plasmid function.

Proper citation: RRID:Addgene_38157 Copy   


  • RRID:Addgene_38160

http://www.addgene.org/38160

Species: Homo sapiens
Genetic Insert: Bcr
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14614449
Comments: Constructed by Anja Reichert. Generated in a 3-way ligation consisting of 5' 0.6 kb BamHI/SalI + 3' 3.5 kb SalI/XbaI BCR fragments into pLEF digested with BamHIxXbaI. The BCR insert contains the natural TAG and 3' UT sequences. At the 3' end there are polylinker sequences from pSK.

Proper citation: RRID:Addgene_38160 Copy   


http://www.addgene.org/38161

Species: Homo sapiens
Genetic Insert: Bcr/Abl P210
Vector Backbone Description: Backbone Marker:Pharmingen; Backbone Size:8530; Vector Backbone:pAcG2T; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Nora Heisterkamp. Made using a 3-way ligation with 0.6 kb 5' BamHI-SalI from BCR + 3' 7.5 kb Sal I-EcoRI into pAcG2T. Not evaluated for protein production.

Proper citation: RRID:Addgene_38161 Copy   


  • RRID:Addgene_38149

    This resource has 1+ mentions.

http://www.addgene.org/38149

Species: Caenorhabditis elegans
Genetic Insert: cbr-unc-119::FRT*::galk::FRT*
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin
Comments: This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene. The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants.

Proper citation: RRID:Addgene_38149 Copy   


  • RRID:Addgene_38145

http://www.addgene.org/38145

Species: Caenorhabditis elegans
Genetic Insert: ptc-3::GFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21215260
Comments: The pPK348 plasmid was derived by inserting the GFP cassette from pPD103.87 (Addgene plasmid 1524) flanked by XbaI ends into the unique SpeI site present in exon 8 of ptc-3 and carries the entire predicted ptc-3 locus comprised of a 6.9 kb genomic coding region fused in-frame to GFP and more than 5 kb of 5′ upstream sequence, including the putative promoter Please note that Addgene's sequencing results identified several mismatches in the region of bp#722-824 when compared to the full plasmid sequence provided by the depositing laboratory. The depositor states that these mismatches are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_38145 Copy   


  • RRID:Addgene_38146

http://www.addgene.org/38146

Species: Caenorhabditis elegans
Genetic Insert: let-60p::ptc-3::gfp
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21215260
Comments: The pPK700 plasmid was derived by ligating the let-60 promoter region to ptc-3::gfp expression cassette, which was PCR amplified from pPK348 (Addgene plasmid 38145)

Proper citation: RRID:Addgene_38146 Copy   


  • RRID:Addgene_38142

    This resource has 10+ mentions.

http://www.addgene.org/38142

Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer. The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid. For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson

Proper citation: RRID:Addgene_38142 Copy   


  • RRID:Addgene_38143

    This resource has 10+ mentions.

http://www.addgene.org/38143

Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson

Proper citation: RRID:Addgene_38143 Copy   


  • RRID:Addgene_38150

http://www.addgene.org/38150

Species: M. anisopliae
Genetic Insert: Carboxypeptidase A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6526; Vector Backbone:pFastBac-1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21073956

Proper citation: RRID:Addgene_38150 Copy   


  • RRID:Addgene_38136

    This resource has 1+ mentions.

http://www.addgene.org/38136

Species: Mus musculus
Genetic Insert: Jhdm2a
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA4/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722204

Proper citation: RRID:Addgene_38136 Copy   


  • RRID:Addgene_38132

    This resource has 1+ mentions.

http://www.addgene.org/38132

Species: Homo sapiens
Genetic Insert: MITF-A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22692423

Proper citation: RRID:Addgene_38132 Copy   


  • RRID:Addgene_38240

    This resource has 10+ mentions.

http://www.addgene.org/38240

Species: Rattus norvegicus
Genetic Insert: 4EBP1
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:5000; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22552098

Proper citation: RRID:Addgene_38240 Copy   


  • RRID:Addgene_38094

http://www.addgene.org/38094

Species: Mus musculus
Genetic Insert: Smo
Vector Backbone Description: Vector Backbone:pGE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12414725

Proper citation: RRID:Addgene_38094 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X