Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: mPGK, GDNF, rtTR-KRAB-2SM2, Tet-Off
Vector Backbone Description: Backbone Size:11516; Vector Backbone:pLVPT-rtTR-KRAB-2SM2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432520
Comments: Transgenes can be expressed from any RNA Pol II promoter as part of
bicistronic unit comprising the KRAB-based repressor; tetO sequences
are inserted into the vector LTR. Tet-on and Tet-off versions rely on
repressors that bind in the absence or the presence of doxycycline,
respectively. Addition of Pol III promoter-small hairpin RNA cassette
allows for drug-controllable RNA interference (Tet-on shRNA).
Cloning shRNA into pLVET, pLVCT, and pLVPT vectors: first clone
shRNA into pLVTHM downstream of the tetO-H1 region. Then cut pLVTHM
containing your shRNA with MscI-FspI and clone the insert containing
the 3'LTR to target plasmid opened with MscI-FspI. FspI cuts into
AmpR. This means for inverted clones AmpR will not be restored; after
selection you will be left with clones with the shRNA cassette and
functional AmpR.
pLVTHM and packaging plasmid for this system are also available at Addgene http://www.addgene.org/rnaitools Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked
questions on cloning strategies and packaging.
Proper citation: RRID:Addgene_11647 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116479 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116500 Copy
Species: Homo sapiens
Genetic Insert: PDGFRA
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116453 Copy
Species: Homo sapiens
Genetic Insert: hUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on
Vector Backbone Description: Backbone Size:11876; Vector Backbone:pLVUT-tTR-KRAB; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432520
Comments: Transgenes can be expressed from any RNA Pol II promoter as part of
bicistronic unit comprising the KRAB-based repressor; tetO sequences
are inserted into the vector LTR. Tet-on and Tet-off versions rely on
repressors that bind in the absence or the presence of doxycycline,
respectively. Addition of Pol III promoter-small hairpin RNA cassette
allows for drug-controllable RNA interference (Tet-on shRNA).
Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked
questions on cloning strategies and packaging.
Proper citation: RRID:Addgene_11650 Copy
Genetic Insert: hUbiquitin C, GFP, tTR-KRAB, Tet-on
Vector Backbone Description: Backbone Size:11480; Vector Backbone:None; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432520
Comments: Transgenes can be expressed from any RNA Pol II promoter as part of bicistronic unit comprising the KRAB-based repressor; tetO sequences are inserted into the vector LTR. Tet-on and Tet-off versions rely on repressors that bind in the absence or the presence of doxycycline, respectively. Addition of Pol III promoter-small hairpin RNA cassette allows for drug-controllable RNA interference (Tet-on shRNA).
pLVTHM and packaging plasmid for this system are also available at Addgene http://www.addgene.org/rnaitools Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked
questions on cloning strategies and packaging.
Note: There is another EcoRI site at 6235 that is not depicted in the author's map.
Proper citation: RRID:Addgene_11651 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116457 Copy
Species: Homo sapiens
Genetic Insert: NRAS
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116444 Copy
Species: Homo sapiens
Genetic Insert: PIK3CB
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116553 Copy
Species: Homo sapiens
Genetic Insert: PIK3CB
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116551 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116539 Copy
Species: Homo sapiens
Genetic Insert: hUbiquitin C, GFP, tTR-KRAB, shRNA against TP53, no tetO
Vector Backbone Description: Backbone Size:11579; Vector Backbone:pLVU-tTR-KRAB; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432520
Comments: Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging.
Proper citation: RRID:Addgene_11654 Copy
Species: Homo sapiens
Genetic Insert: GFP, shRNA against TP53
Vector Backbone Description: Backbone Size:9931; Vector Backbone:None; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432520
Comments: Please visit the Trono lab website: http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging.
shRNA sequence 5'-AGTAGATTACCACTGGAGTCTT
Proper citation: RRID:Addgene_11653 Copy
Vector Backbone Description: Backbone Size:8633; Vector Backbone:pPRIME-CMV-GFP-recipient; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16141338
Comments: This recipient plasmid contains pheS Gly294 between the I-SceI sites, which can be selected against using Cl-Phe.
Proper citation: RRID:Addgene_11657 Copy
Vector Backbone Description: Backbone Size:8719; Vector Backbone:pPRIME-CMV-Neo-recipient; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16141338
Comments: This recipient plasmid contains pheS Gly294 between the I-SceI sites, which can be selected against using Cl-Phe.
Proper citation: RRID:Addgene_11659 Copy
Species: Homo sapiens
Genetic Insert: ALK
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116712 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11665 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11662 Copy
Species: Homo sapiens
Genetic Insert: BMPR2
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116718 Copy
Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533785
Proper citation: RRID:Addgene_116719 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
