Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLVPT-GDNF-rtTR-KRAB-2SM2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11647 | mPGK, GDNF, rtTR-KRAB-2SM2, Tet-Off | Homo sapiens | Ampicillin | PMID:16432520 | Transgenes can be expressed from any RNA Pol II promoter as part of bicistronic unit comprising the KRAB-based repressor; tetO sequences are inserted into the vector LTR. Tet-on and Tet-off versions rely on repressors that bind in the absence or the presence of doxycycline, respectively. Addition of Pol III promoter-small hairpin RNA cassette allows for drug-controllable RNA interference (Tet-on shRNA). Cloning shRNA into pLVET, pLVCT, and pLVPT vectors: first clone shRNA into pLVTHM downstream of the tetO-H1 region. Then cut pLVTHM containing your shRNA with MscI-FspI and clone the insert containing the 3'LTR to target plasmid opened with MscI-FspI. FspI cuts into AmpR. This means for inverted clones AmpR will not be restored; after selection you will be left with clones with the shRNA cassette and functional AmpR. pLVTHM and packaging plasmid for this system are also available at Addgene http://www.addgene.org/rnaitools Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging. | Backbone Size:11516; Vector Backbone:pLVPT-rtTR-KRAB-2SM2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:13 | 2 | |
|
pHAGE-PIK3CA-E542K Resource Report Resource Website 1+ mentions |
RRID:Addgene_116479 | PIK3CA | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | E542K | 2026-09-05 12:45:13 | 5 | |
|
pHAGE-PIK3CA-H1047R Resource Report Resource Website 1+ mentions |
RRID:Addgene_116500 | PIK3CA | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | H1047R | 2026-09-05 12:45:13 | 7 | |
|
pHAGE-PDGFRA-Y288C Resource Report Resource Website 1+ mentions |
RRID:Addgene_116453 | PDGFRA | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Y288C | 2026-09-05 12:45:12 | 1 | |
|
pLVUTHshGATA1-tTR-KRAB Resource Report Resource Website 1+ mentions |
RRID:Addgene_11650 | hUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on | Homo sapiens | Ampicillin | PMID:16432520 | Transgenes can be expressed from any RNA Pol II promoter as part of bicistronic unit comprising the KRAB-based repressor; tetO sequences are inserted into the vector LTR. Tet-on and Tet-off versions rely on repressors that bind in the absence or the presence of doxycycline, respectively. Addition of Pol III promoter-small hairpin RNA cassette allows for drug-controllable RNA interference (Tet-on shRNA). Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging. | Backbone Size:11876; Vector Backbone:pLVUT-tTR-KRAB; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:13 | 4 | |
|
pLVUT-tTR-KRAB Resource Report Resource Website 1+ mentions |
RRID:Addgene_11651 | hUbiquitin C, GFP, tTR-KRAB, Tet-on | Ampicillin | PMID:16432520 | Transgenes can be expressed from any RNA Pol II promoter as part of bicistronic unit comprising the KRAB-based repressor; tetO sequences are inserted into the vector LTR. Tet-on and Tet-off versions rely on repressors that bind in the absence or the presence of doxycycline, respectively. Addition of Pol III promoter-small hairpin RNA cassette allows for drug-controllable RNA interference (Tet-on shRNA). pLVTHM and packaging plasmid for this system are also available at Addgene http://www.addgene.org/rnaitools Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging. Note: There is another EcoRI site at 6235 that is not depicted in the author's map. | Backbone Size:11480; Vector Backbone:None; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:13 | 4 | ||
|
pHAGE-PIK3CA-C420R Resource Report Resource Website 1+ mentions |
RRID:Addgene_116457 | PIK3CA | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | C420R | 2026-09-05 12:45:12 | 1 | |
|
pHAGE-NRAS-Q61K Resource Report Resource Website 1+ mentions |
RRID:Addgene_116444 | NRAS | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Q61K | 2026-09-05 12:45:12 | 1 | |
|
pHAGE-PIK3CB-E1051K Resource Report Resource Website 1+ mentions |
RRID:Addgene_116553 | PIK3CB | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | E1051K | 2026-09-05 12:45:14 | 1 | |
|
pHAGE-PIK3CB-D1067Y Resource Report Resource Website 1+ mentions |
RRID:Addgene_116551 | PIK3CB | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | D1067Y | 2026-09-05 12:45:14 | 1 | |
|
pHAGE-PIK3CA-R93P Resource Report Resource Website 1+ mentions |
RRID:Addgene_116539 | PIK3CA | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | R93P | 2026-09-05 12:45:13 | 1 | |
|
pLVUHshp53-tTR-KRAB Resource Report Resource Website 1+ mentions |
RRID:Addgene_11654 | hUbiquitin C, GFP, tTR-KRAB, shRNA against TP53, no tetO | Homo sapiens | Ampicillin | PMID:16432520 | Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging. | Backbone Size:11579; Vector Backbone:pLVU-tTR-KRAB; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:13 | 1 | |
|
pLVUHshp53 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11653 | GFP, shRNA against TP53 | Homo sapiens | Ampicillin | PMID:16432520 | Please visit the Trono lab website: http://tronolab.epfl.ch to see frequently asked questions on cloning strategies and packaging. shRNA sequence 5'-AGTAGATTACCACTGGAGTCTT | Backbone Size:9931; Vector Backbone:None; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:13 | 9 | |
|
pPRIME-CMV-GFP-recipient Resource Report Resource Website 1+ mentions |
RRID:Addgene_11657 | Ampicillin | PMID:16141338 | This recipient plasmid contains pheS Gly294 between the I-SceI sites, which can be selected against using Cl-Phe. | Backbone Size:8633; Vector Backbone:pPRIME-CMV-GFP-recipient; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:14 | 1 | |||
|
pPRIME-CMV-Neo-recipient Resource Report Resource Website 1+ mentions |
RRID:Addgene_11659 | Ampicillin | PMID:16141338 | This recipient plasmid contains pheS Gly294 between the I-SceI sites, which can be selected against using Cl-Phe. | Backbone Size:8719; Vector Backbone:pPRIME-CMV-Neo-recipient; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-05 12:45:14 | 1 | |||
|
pHAGE-ALK Resource Report Resource Website 1+ mentions |
RRID:Addgene_116712 | ALK | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | WT | 2026-09-05 12:45:15 | 1 | |
|
pPRIME-CMV-Neo-FF3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11665 | FF3 | Firefly | Chloramphenicol | PMID:16141338 | CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC) | Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol | 2026-09-05 12:45:15 | 3 | |
|
pPRIME-TET-GFP-FF3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11662 | FF3 | Firefly | Chloramphenicol | PMID:16141338 | TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC) | Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol | 2026-09-05 12:45:14 | 1 | |
|
pHAGE-BMPR2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_116718 | BMPR2 | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | WT | 2026-09-05 12:45:15 | 1 | |
|
pHAGE-BRAF Resource Report Resource Website 1+ mentions |
RRID:Addgene_116719 | BRAF | Homo sapiens | Ampicillin | PMID:29533785 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | WT | 2026-09-05 12:45:15 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
