Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: None
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479688
Comments: parts.igem.org/Part:pSB1K3
Proper citation: RRID:Addgene_66067 Copy
Species: Synthetic
Genetic Insert: None
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Gateway Cloning, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479688
Comments: parts.igem.org/Part:pSB1K3
Proper citation: RRID:Addgene_66071 Copy
Genetic Insert: 2xtRNA-SupD
Vector Backbone Description: Vector Backbone:pKD; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26350500
Comments: See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression.
Proper citation: RRID:Addgene_68307 Copy
Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 584; Emission = 607
Proper citation: RRID:Addgene_55925 Copy
Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Backbone Size:4750; Vector Backbone:rsEGFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_56533 Copy
Species: Homo sapiens
Genetic Insert: NM_003380.3
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18454154
Comments: . Excitation = 555; Emission = 584
Proper citation: RRID:Addgene_58029 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pHT-01; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61325 Copy
Species: Homo sapiens
Genetic Insert: H2B-GFP
Vector Backbone Description: Backbone Marker:Bob Weinberg, Addgene plasmid 1764; Backbone Size:5200; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20551166
Comments: H2B-GFP was cloned from pBOS-H2B-GFP (BD Biosciences) into the pBABE retroviral vector.
Proper citation: RRID:Addgene_26790 Copy
Species: Mus musculus
Genetic Insert: autophagy-related 3 (yeast)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20723759
Proper citation: RRID:Addgene_26926 Copy
Species: Homo sapiens
Genetic Insert: IDH1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19359588
Proper citation: RRID:Addgene_62923 Copy
Species: Homo sapiens
Genetic Insert: IDH1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19359588
Proper citation: RRID:Addgene_62924 Copy
Species: Synthetic
Genetic Insert: CTG REPEATS
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: Addgene cannot verify or guarantee the presence of all 700 CTG repeats in this array
Should be amplified in STBL3 bacteria and grown at Room temperature to keep the repeats stable.
This plasmid should be verified via restriction analysis. Multiple colonies may need to be screened to isolate the correct construct.
Proper citation: RRID:Addgene_63087 Copy
Species: Homo sapiens
Genetic Insert: expanded CGG repeats (99 repeats) within the 5'UTR of FMR1
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Should be amplified in STBL3 bacteria and grown at Room temperature to keep the repeats stable.
This construct allows translation of CGG repeats into 99 glycine due to a near cognate ATG codon upstream of the repeat in the 5'UTR of FMR1 (an ACG codon that initiates weakly translation).
This plasmid should be verified via restriction analysis. Multiple colonies may need to be screened to isolate the correct construct.
Proper citation: RRID:Addgene_63089 Copy
Genetic Insert: DV2 prM-E
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29999491
Comments: Please visit https://www.biorxiv.org/content/early/2018/03/22/286955 for bioRxiv preprint.
Proper citation: RRID:Addgene_63161 Copy
Species: Homo sapiens
Genetic Insert: STAT3
Vector Backbone Description: Backbone Marker:John Doench/Kathleen Ottina; Backbone Size:9240; Vector Backbone:pcw107 (V5); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25538079
Comments: CAGA (N-term barcode, 17 nt upstream of CDS start). Working name: CTK-D2-V5
Proper citation: RRID:Addgene_64611 Copy
Species: Homo sapiens
Genetic Insert: EPO
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti6.3/V5-DEST gateway vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937702
Comments: Human erythropoietin (hEPO) ORF with stop codon (582 bp; Ultimate ORF clone number IOH7334) from GeneCopoeia ORF cDNA clones in pDONR vector (GeneCopoeia; GC-A1011).
Because the stop codon is inserted before V5 epitope, the V5 tag on the pLenti6.3/V5-DEST vector won’t be transcribed.
Proper citation: RRID:Addgene_50436 Copy
Genetic Insert: plant 3'UTRpolyadenylation signal/terminator, Tom H4
Vector Backbone Description: Vector Backbone:pICH41276; Vector Types:Other, Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24933124
Proper citation: RRID:Addgene_51834 Copy
Species: Homo sapiens
Genetic Insert: COL6A1
Vector Backbone Description: Backbone Marker:Lawson Lab (Addgene Plasmid 22423); Backbone Size:4095; Vector Backbone:pCSDest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29760202
Comments: BC052575
Proper citation: RRID:Addgene_53893 Copy
Species: Homo sapiens
Genetic Insert: Desmoglein1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 568; Emission = 592
Proper citation: RRID:Addgene_54887 Copy
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene.
Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer:
SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:
none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3'
StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3'
S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3'
CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3'
HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3'
Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
Proper citation: RRID:Addgene_55187 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.