Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Authority:addgene (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

178,636 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
DVK_AE
 
Resource Report
Resource Website 		RRID:Addgene_66067 None Synthetic Kanamycin PMID:26479688 parts.igem.org/Part:pSB1K3 Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin 2026-08-29 01:09:01 0
DVK_GH
 
Resource Report
Resource Website 		RRID:Addgene_66071 None Synthetic Kanamycin PMID:26479688 parts.igem.org/Part:pSB1K3 Vector Backbone:DVK; Vector Types:Gateway Cloning, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:08:56 0
SupD
 
Resource Report
Resource Website 		RRID:Addgene_68307 2xtRNA-SupD Kanamycin PMID:26350500 See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression. Vector Backbone:pKD; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:09:15 0
mRFP1-Zyxin-6
 
Resource Report
Resource Website 		RRID:Addgene_55925 Zyxin Homo sapiens Kanamycin . Excitation = 584; Emission = 607 Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:26 0
rsEGFP2-H2B-6
 
Resource Report
Resource Website 		RRID:Addgene_56533 H2B Homo sapiens Kanamycin Backbone Size:4750; Vector Backbone:rsEGFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin D26G and V119I in H2B 2026-08-29 01:07:31 0
mTagRFP-T-Vimentin-7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58029 NM_003380.3 Homo sapiens Kanamycin PMID:18454154 . Excitation = 555; Emission = 584 Backbone Size:4750; Vector Backbone:mTagRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:48 2
pCri-17a
 
Resource Report
Resource Website 		RRID:Addgene_61325 Green fluorescent protein Ampicillin PMID:25386923 Vector Backbone:pHT-01; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:15 0
pBABE-H2BGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26790 H2B-GFP Homo sapiens Ampicillin PMID:20551166 H2B-GFP was cloned from pBOS-H2B-GFP (BD Biosciences) into the pBABE retroviral vector. Backbone Marker:Bob Weinberg, Addgene plasmid 1764; Backbone Size:5200; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:03:11 12
pBABEpuro WT ATG3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26926 autophagy-related 3 (yeast) Mus musculus Ampicillin PMID:20723759 Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:03:12 1
pBabe-puro-Flag-IDH1
 
Resource Report
Resource Website 		RRID:Addgene_62923 IDH1 Homo sapiens Ampicillin PMID:19359588 Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:08:28 0
pBabe-puro-Flag-IDH1-R132H
 
Resource Report
Resource Website 		RRID:Addgene_62924 IDH1 Homo sapiens Ampicillin PMID:19359588 Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin mutation Arg132His 2026-08-29 01:08:31 0
pAAV CTG 700x
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_63087 CTG REPEATS Synthetic Ampicillin Addgene cannot verify or guarantee the presence of all 700 CTG repeats in this array Should be amplified in STBL3 bacteria and grown at Room temperature to keep the repeats stable. This plasmid should be verified via restriction analysis. Multiple colonies may need to be screened to isolate the correct construct. Vector Backbone:unknown; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin CTG 700x that is the mutation found in Myotonic Dystrophic type 1 2026-08-29 01:08:29 1
5'UTR CGG 99x FMR1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_63089 expanded CGG repeats (99 repeats) within the 5'UTR of FMR1 Homo sapiens Ampicillin Should be amplified in STBL3 bacteria and grown at Room temperature to keep the repeats stable. This construct allows translation of CGG repeats into 99 glycine due to a near cognate ATG codon upstream of the repeat in the 5'UTR of FMR1 (an ACG codon that initiates weakly translation). This plasmid should be verified via restriction analysis. Multiple colonies may need to be screened to isolate the correct construct. Vector Backbone:unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:33 2
DV2 VLPs pVRC8400
 
Resource Report
Resource Website 		RRID:Addgene_63161 DV2 prM-E Kanamycin PMID:29999491 Please visit https://www.biorxiv.org/content/early/2018/03/22/286955 for bioRxiv preprint. Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:08:30 0
Stat3 (A662C,N664C,V667L)-pcw107-V5
 
Resource Report
Resource Website 		RRID:Addgene_64611 STAT3 Homo sapiens Ampicillin PMID:25538079 CAGA (N-term barcode, 17 nt upstream of CDS start). Working name: CTK-D2-V5 Backbone Marker:John Doench/Kathleen Ottina; Backbone Size:9240; Vector Backbone:pcw107 (V5); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin A662C, N664C, V667L 2026-08-29 01:08:43 0
pLenti6.3-hEPO
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50436 EPO Homo sapiens Ampicillin PMID:21937702 Human erythropoietin (hEPO) ORF with stop codon (582 bp; Ultimate ORF clone number IOH7334) from GeneCopoeia ORF cDNA clones in pDONR vector (GeneCopoeia; GC-A1011). Because the stop codon is inserted before V5 epitope, the V5 tag on the pLenti6.3/V5-DEST vector won’t be transcribed. Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti6.3/V5-DEST gateway vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:06:31 2
pICH71421
 
Resource Report
Resource Website 		RRID:Addgene_51834 plant 3'UTRpolyadenylation signal/terminator, Tom H4 Spectinomycin PMID:24933124 Vector Backbone:pICH41276; Vector Types:Other, Plant Expression; Bacterial Resistance:Spectinomycin BsaI/BbsI sites removed by point-mutation 2026-08-29 01:06:43 0
COL6A1_pCSdest
 
Resource Report
Resource Website 		RRID:Addgene_53893 COL6A1 Homo sapiens Ampicillin PMID:29760202 BC052575 Backbone Marker:Lawson Lab (Addgene Plasmid 22423); Backbone Size:4095; Vector Backbone:pCSDest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:07:02 0
mApple-Desmoglein1-C-18
 
Resource Report
Resource Website 		RRID:Addgene_54887 Desmoglein1 Homo sapiens Kanamycin . Excitation = 568; Emission = 592 Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:13 0
pCoofy49
 
Resource Report
Resource Website 		RRID:Addgene_55187 Kanamycin PMID:23410102 C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:17 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch