Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 3 showing 41 ~ 60 out of 178,636 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_49887

http://www.addgene.org/49887

Species: Homo sapiens
Genetic Insert: Rab4BS22N
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_49887 Copy   


  • RRID:Addgene_49886

http://www.addgene.org/49886

Species: Homo sapiens
Genetic Insert: Rab4B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_49886 Copy   


  • RRID:Addgene_49889

http://www.addgene.org/49889

Species: Homo sapiens
Genetic Insert: Rab6B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_49889 Copy   


  • RRID:Addgene_49880

http://www.addgene.org/49880

Species: Homo sapiens
Genetic Insert: Rab35
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49880 Copy   


  • RRID:Addgene_49883

http://www.addgene.org/49883

Species: Homo sapiens
Genetic Insert: Arf6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_49883 Copy   


  • RRID:Addgene_49882

http://www.addgene.org/49882

Species: Homo sapiens
Genetic Insert: Rab35
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49882 Copy   


  • RRID:Addgene_49881

http://www.addgene.org/49881

Species: Homo sapiens
Genetic Insert: Rab35
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49881 Copy   


  • RRID:Addgene_49877

http://www.addgene.org/49877

Species: Homo sapiens
Genetic Insert: Rab30
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49877 Copy   


  • RRID:Addgene_50260

http://www.addgene.org/50260

Species: Arabidopsis thaliana
Genetic Insert: promoter, RbcS3B (AT5g38410, A. thaliana)
Vector Backbone Description: Vector Backbone:pICH41233; Vector Types:Other, plant expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24933124
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_50260 Copy   


  • RRID:Addgene_50307

http://www.addgene.org/50307

Species: Other
Genetic Insert: signal peptide, NbCRT calreticulin (Nicotiana benthamiana)
Vector Backbone Description: Vector Backbone:PICH41258; Vector Types:Other, plant expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24933124
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_50307 Copy   


  • RRID:Addgene_50268

    This resource has 1+ mentions.

http://www.addgene.org/50268

Species: Other
Genetic Insert: promoter (0.4 kb), 35s (Cauliflower Mosaic Virus) + 5'UTR, omega (Tobacco Mosaic Virus)
Vector Backbone Description: Vector Backbone:pICH41295; Vector Types:Other, plant expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24933124
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_50268 Copy   


  • RRID:Addgene_50300

http://www.addgene.org/50300

Species: Other
Genetic Insert: N terminal HA tag (6x Human influenza hemagglutinin)
Vector Backbone Description: Vector Backbone:pAGM1276; Vector Types:Other, plant expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24933124
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_50300 Copy   


  • RRID:Addgene_50436

    This resource has 1+ mentions.

http://www.addgene.org/50436

Species: Homo sapiens
Genetic Insert: EPO
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti6.3/V5-DEST gateway vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937702
Comments: Human erythropoietin (hEPO) ORF with stop codon (582 bp; Ultimate ORF clone number IOH7334) from GeneCopoeia ORF cDNA clones in pDONR vector (GeneCopoeia; GC-A1011). Because the stop codon is inserted before V5 epitope, the V5 tag on the pLenti6.3/V5-DEST vector won’t be transcribed.

Proper citation: RRID:Addgene_50436 Copy   


http://www.addgene.org/54887

Species: Homo sapiens
Genetic Insert: Desmoglein1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 568; Emission = 592

Proper citation: RRID:Addgene_54887 Copy   


  • RRID:Addgene_55187

http://www.addgene.org/55187

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55187 Copy   


  • RRID:Addgene_55925

http://www.addgene.org/55925

Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 584; Emission = 607

Proper citation: RRID:Addgene_55925 Copy   


  • RRID:Addgene_53178

    This resource has 1+ mentions.

http://www.addgene.org/53178

Species: Mus musculus
Genetic Insert: CMYC
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435
Comments: The mutations found during the QC process have no functional consequence.

Proper citation: RRID:Addgene_53178 Copy   


http://www.addgene.org/53176

Species: Homo sapiens
Genetic Insert: MEK1 (1-201)-MEK5 (498–1344) fusion
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435
Comments: The sequence discrepancies found during the QC process have no functional consequence.

Proper citation: RRID:Addgene_53176 Copy   


  • RRID:Addgene_53195

    This resource has 1+ mentions.

http://www.addgene.org/53195

Species: Homo sapiens
Genetic Insert: MEK1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435

Proper citation: RRID:Addgene_53195 Copy   


http://www.addgene.org/53199

Species: Homo sapiens
Genetic Insert: MEK5
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435
Comments: The sequence discrepancies found during the QC process have no functional consequence.

Proper citation: RRID:Addgene_53199 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X