Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: Cascade factors (Cse1(Cas8), Cse2(Cas11), Cas5, Cas6, Cas7) with bpNLS
Vector Backbone Description: Backbone Marker:Mashimo Lab at the Univiersity of Tokyo; Vector Backbone:Synthesized; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31811138
Proper citation: RRID:Addgene_134919 Copy
Species: E. coli
Genetic Insert: Cas3 with bpNLS
Vector Backbone Description: Backbone Marker:Wellcome Sanger Institute; Vector Backbone:pPB-CAG-EBNXN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31811138
Proper citation: RRID:Addgene_134920 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Vector Backbone:pBBR1MCS-2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34333160
Comments: Plasmid parts were assembled using Golden gate method
Proper citation: RRID:Addgene_134888 Copy
Species: E. coli
Genetic Insert: crRNA for CRISPR-Cas3
Vector Backbone Description: Vector Backbone:pBSIIKS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31811138
Proper citation: RRID:Addgene_134921 Copy
Species: Homo sapiens
Genetic Insert: Rap1A, mCerulean3, RaIGDS RBD, YPet
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31444239
Proper citation: RRID:Addgene_134926 Copy
Species: Homo sapiens
Genetic Insert: Rap1B, Cerulean
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pXFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31444239
Proper citation: RRID:Addgene_134928 Copy
Species: Gallus gallus
Genetic Insert: cOVA
Vector Backbone Description: Backbone Size:8533; Vector Backbone:pLVX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_135073 Copy
Vector Backbone Description: Backbone Size:8668; Vector Backbone:pJOE7706.1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24863652
Comments: Please note: Plasmid contains a S30Y mutation in EGFP. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_135075 Copy
Species: E.coli
Genetic Insert: rhaR rhaS rhaPBAD eGFP, mob
Vector Backbone Description: Vector Backbone:pJOE4776.1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19789867
Proper citation: RRID:Addgene_135088 Copy
Species: Homo sapiens
Genetic Insert: NEMO
Vector Backbone Description: Backbone Marker:Made in Guan Lab; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for more information.
Proper citation: RRID:Addgene_13512 Copy
Vector Backbone Description: Backbone Size:5288; Vector Backbone:pOO2-GW; Vector Types:bacterial expression vector for generating SP6 transcripts in vitro for Xenopus oocyte transfection; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21107422
Comments: The AtAMT1;1 coding sequence with the att sites (attB1 and attB2) from the pDRf1-AtAMT1;1 (Loque et al 2007 Nature 446 195-198) was remobilized with both restriction enzymes SpeI and XhoI then subsequently cloned between SpeI and XhoI sites in the p6013-002 (Ludewig et al., 2002 J. Biol. Chem. 277, 13548-13555). The AtAMT1;1 coding sequence was then replaced by the Gateway DNA cassette after a BP reaction with pDONR 221 (GATEWAY technology, Invitrogen) to generate the p002-GW vector.
Proper citation: RRID:Addgene_135097 Copy
Species: Homo sapiens
Genetic Insert: FKHR H215R AAA
Vector Backbone Description: Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for map of wild-type pcDNA3-flag-FKHR.
Proper citation: RRID:Addgene_13510 Copy
Species: Homo sapiens
Genetic Insert: 3xIRS
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5800; Vector Backbone:pGL2-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS.
See "Author's Map" for more information.
Proper citation: RRID:Addgene_13511 Copy
Species: Homo sapiens
Genetic Insert: MKK6(glu)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Proper citation: RRID:Addgene_13518 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Proper citation: RRID:Addgene_13517 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Green lab; Backbone Size:3301; Vector Backbone:Z1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:42490567
Proper citation: RRID:Addgene_135046 Copy
Species: Homo sapiens
Genetic Insert: FKHR H215R
Vector Backbone Description: Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for map of wild-type pcDNA3-flag-FKHR.
Proper citation: RRID:Addgene_13509 Copy
Species: Homo sapiens
Genetic Insert: SMURF2
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11163210
Proper citation: RRID:Addgene_13505 Copy
Species: Synthetic
Genetic Insert: sfGFP_RED20
Vector Backbone Description: Backbone Size:2000; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31511890
Proper citation: RRID:Addgene_135173 Copy
Species: Mus musculus
Genetic Insert: TPC2
Vector Backbone Description: Backbone Size:8080; Vector Backbone:pLVXpuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25872774
Comments: IMAGE clone: 9055807
ImaGenes collection: IRCKp5014F1215Q
GeneBank: BC141195
Proper citation: RRID:Addgene_135183 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
