Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 25 showing 481 ~ 500 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_112037

    This resource has 1+ mentions.

http://www.addgene.org/112037

Genetic Insert: Gal DNA binding-estradiol binding-MSN2 activator
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29348368

Proper citation: RRID:Addgene_112037 Copy   


http://www.addgene.org/112021

Species: Homo sapiens
Genetic Insert: NYESO beta/alpha into TRAC HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA

Proper citation: RRID:Addgene_112021 Copy   


http://www.addgene.org/112012

Species: Homo sapiens
Genetic Insert: RAB11A-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG

Proper citation: RRID:Addgene_112012 Copy   


http://www.addgene.org/112013

Species: Homo sapiens
Genetic Insert: RAB11A-mCherry HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG

Proper citation: RRID:Addgene_112013 Copy   


http://www.addgene.org/112005

Species: Synthetic
Genetic Insert: axon-GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production

Proper citation: RRID:Addgene_112005 Copy   


http://www.addgene.org/112008

Species: Synthetic
Genetic Insert: axon-GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:5109; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424

Proper citation: RRID:Addgene_112008 Copy   


http://www.addgene.org/112006

Species: Synthetic
Genetic Insert: GCaMP6s-P2A-mKate2
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production

Proper citation: RRID:Addgene_112006 Copy   


http://www.addgene.org/112007

Species: Synthetic
Genetic Insert: GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production

Proper citation: RRID:Addgene_112007 Copy   


  • RRID:Addgene_11504

    This resource has 1+ mentions.

http://www.addgene.org/11504

Species: Homo sapiens
Genetic Insert: Frataxin
Vector Backbone Description: Backbone Marker:pBABE-hygro is available at Addgene; Backbone Size:5558; Vector Backbone:pBABE hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11035806
Comments: This plasmid was cloned before there was any consensus sequence for frataxin. There are 2 mutations with the currently available frataxin sequence - L140P R165C. The effect of these mutations is unknown.

Proper citation: RRID:Addgene_11504 Copy   


  • RRID:Addgene_11510

    This resource has 10+ mentions.

http://www.addgene.org/11510

Genetic Insert: Firefly luciferase, Hepatitis C Virus IRES sequence, Renilla, and 3'UTR short RNA binding sites
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16483934
Comments: The plasmid constructed by PCR cloning HCV IRES into the NheI site of pRL-TKx6 and inserting the Firefly luciferase ORF from pGL3 into the resulting vectorl.

Proper citation: RRID:Addgene_11510 Copy   


  • RRID:Addgene_11515

    This resource has 1+ mentions.

http://www.addgene.org/11515

Species: Homo sapiens
Genetic Insert: huntingtin, exon 1, 46Q glutamines
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET-32a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12193654

Proper citation: RRID:Addgene_11515 Copy   


  • RRID:Addgene_115144

    This resource has 1+ mentions.

http://www.addgene.org/115144

Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:6087; Vector Backbone:Piggybac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30793977
Comments: Please visit https://www.biorxiv.org/content/early/2018/08/20/396390 for bioRxiv preprint.

Proper citation: RRID:Addgene_115144 Copy   


http://www.addgene.org/115142

Species: Synthetic
Genetic Insert: human codon optimized Mb3Cas12a
Vector Backbone Description: Backbone Marker:Cepko lab (Addgene Plasmid #11179); Vector Backbone:pCAG (Addgene #11179); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30190308

Proper citation: RRID:Addgene_115142 Copy   


http://www.addgene.org/115136

Species: Synthetic
Genetic Insert: human codon optimized AcrVA1 anti-CRISPR protein
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid #43861); Vector Backbone:JDS246 (Plasmid #43861); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30190308

Proper citation: RRID:Addgene_115136 Copy   


http://www.addgene.org/115138

Species: Synthetic
Genetic Insert: human codon optimized AcrVA2 anti-CRISPR protein
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid #43861); Vector Backbone:JDS246 (Plasmid #43861); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30190308

Proper citation: RRID:Addgene_115138 Copy   


http://www.addgene.org/115139

Species: Synthetic
Genetic Insert: human codon optimized AcrVA3.1 anti-CRISPR protein
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid #43861); Vector Backbone:JDS246 (Plasmid #43861); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30190308

Proper citation: RRID:Addgene_115139 Copy   


  • RRID:Addgene_115120

    This resource has 1+ mentions.

http://www.addgene.org/115120

Species: Arabidopsis thaliana
Genetic Insert: AT5G46330
Vector Backbone Description: Backbone Marker:Chris Garcia (Addgene plasmid # 47032); Vector Backbone:pECIA2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29320478
Comments: Plasmid for secreted expression in Drosophila cell culture by induction via CuSO4. Insert is an extracellular domain of indicated LRR-RK, C-terminally tagged with Fc, V5 and hexahistidine tags. Insert Protein Sequence: KQSFEPEIEALKSFKNGISNDPLGVLSDWTIIGSLRHCNWTGITCDSTGHVVSVSLLEKQLEGVLSPAIANLTYLQVLDLTSNSFTGKIPAEIGKLTELNQLILYLNYFSGSIPSGIWELKNIFYLDLRNNLLSGDVPEEICKTSSLVLIGFDYNNLTGKIPECLGDLVHLQMFVAAGNHLTGSIPVSIGTLANLTDLDLSGNQLTGKIPRDFGNLLNLQSLVLTENLLEGDIPAEIGNCSSLVQLELYDNQLTGKIPAELGNLVQLQALRIYKNKLTSSIPSSLFRLTQLTHLGLSENHLVGPISEEIGFLESLEVLTLHSNNFTGEFPQSITNLRNLTVLTVGFNNISGELPADLGLLTNLRNLSAHDNLLTGPIPSSISNCTGLKLLDLSHNQMTGEIPRGFGRMNLTFISIGRNHFTGEIPDDIFNCSNLETLSVADNNLTGTLKPLIGKLQKLRILQVSYNSLTGPIPREIGNLKDLNILYLHSNGFTGRIPREMSNLTLLQGLRMYSNDLEGPIPEEMFDMKLLSVLDLSNNKFSGQIPALFSKLESLTYLSLQGNKFNGSIPASLKSLSLLNTFDISDNLLTGTIPGELLASLKNMQLYLNFSNNLLTGTIPKELGKLEMVQEIDLSNNLFSGSIPRSLQACKNVFTLDFSQNNLSGHIPDEVFQGMDMIISLNLSRNSFSGEIPQSFGNMTHLVSLDLSSNNLTGEIPESLANLSTLKHLKLASNNLKGHVPESGVFKNINASDLMGNTDLCGSKKPLKPCTIKQKSSHFSKR

Proper citation: RRID:Addgene_115120 Copy   


  • RRID:Addgene_1151

    This resource has 1+ mentions.

http://www.addgene.org/1151

Species: Saccharomyces cerevisiae
Genetic Insert: HSP104
Vector Backbone Description: Backbone Size:5703; Vector Backbone:pLA1 (pRS313:GAL1-10); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14978213

Proper citation: RRID:Addgene_1151 Copy   


  • RRID:Addgene_115341

    This resource has 1+ mentions.

http://www.addgene.org/115341

Species: Mus musculus
Genetic Insert: RIPK1
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28842570

Proper citation: RRID:Addgene_115341 Copy   


  • RRID:Addgene_11519

    This resource has 1+ mentions.

http://www.addgene.org/11519

Vector Backbone Description: Backbone Marker:PEL; Backbone Size:8724; Vector Backbone:pDest-590; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_11519 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X