Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Authority:addgene (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

178,636 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBigTB-ERT2CreERT2
 
Resource Report
Resource Website 		RRID:Addgene_149433 ERT2-Cre-ERT2 fusion protein Synthetic Ampicillin PMID:33082936 Backbone Marker:Primo Schär Lab; Backbone Size:4574; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
pBigTB-FlpERT2
 
Resource Report
Resource Website 		RRID:Addgene_149435 Flp-ERT2 fusion protein Synthetic Ampicillin PMID:33082936 Backbone Marker:Primo Schär Lab; Backbone Size:4573; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
pROSA26-ERT2CreERT2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_149436 ERT2-Cre-ERT2 fusion protein Synthetic Ampicillin PMID:33082936 Backbone Marker:Liqun Luo Lab (Addgene Plasmid #40026); Backbone Size:14483; Vector Backbone:pROSA26-TG; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 3
pCMV Fcgamma RIIa IRES neo
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14948 Fcgamma RIIa Homo sapiens Ampicillin PMID:17110435 The FcgRIIa cDNA was amplified by RT-PCR using a Titan One Tube RT-PCR System kit (Roche, Mannheim, Germany) and a pair of primers (5'-TTGAATTCACCATGGAGACCCAAATGTCTC-3' and 5'-GCGGCCGCTTAGTTATTACTGTTGACATGG-3'). The PCR product was cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA) to generate pAC01 and subcloned as an EcoRI–NotI fragment into pIRESneo2 (Clontech, Mountain View, CA) to generate pCMV-FcgRIIa-IRES-Neo. Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 3
pHMGCS-Luc (aka: pES8)
 
Resource Report
Resource Website 		RRID:Addgene_14947 HMG CoA synthase promoter hamster Ampicillin PMID:16141315 To generate pHMGCS-Luc, a PCR fragment containing nucleotides –379 to –17 of the hamster 3-hydroxy-3-methylglutaryl (HMG) CoA synthase gene was cloned into pGL2-basic. PCR'd using primers: CGATCTCCTCTCACTGACCTTC and GCAGCTTTATAGCCACCGACCC. Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
pPD95_77
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_1495 Ampicillin See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD95.77, Ligation number NONE. Backbone Size:4493; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:29 24
pRK5 HA GST Rheb1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14951 Rheb1 Homo sapiens Ampicillin PMID:17386266 Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:29 4
pRK5 HA GST rap2a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_14952 rap2a Homo sapiens Ampicillin PMID:17386266 Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:29 1
pET11b-MIF Y99A
 
Resource Report
Resource Website 		RRID:Addgene_149440 MIF Homo sapiens Ampicillin For protein expression, use BL21-Gold (DE3) E. coli Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Y99A 2026-09-05 12:49:28 0
pET11b-MIF H62Y
 
Resource Report
Resource Website 		RRID:Addgene_149442 MIF Homo sapiens Ampicillin For protein expression, use BL21-Gold (DE3) E. coli Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin H62Y 2026-09-05 12:49:28 0
pET11b-MIF H62A
 
Resource Report
Resource Website 		RRID:Addgene_149443 MIF Homo sapiens Ampicillin For protein expression, use BL21-Gold (DE3) E. coli Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin H62A 2026-09-05 12:49:28 0
pET11b-MIF H62F
 
Resource Report
Resource Website 		RRID:Addgene_149445 MIF Homo sapiens Ampicillin For protein expression, use BL21-Gold (DE3) E. coli Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin H62F 2026-09-05 12:49:28 0
pK18-hACE2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_149449 Angiotensin-converting enzyme 2 Homo sapiens Ampicillin PMID:17079315 The vector includes 5' and 3' genomic regions of the human K18 gene, necessary for driving high-level epithelial-cell-specific expression Backbone Marker:Tropix, Bedford, MA; Backbone Size:7114; Vector Backbone:pSEAP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 2
Anti-GluK5/Grik5/KA2 kainate receptor [N279B/27R]
 
Resource Report
Resource Website 		RRID:Addgene_149451 anti-GluK5/Grik5/KA2 kainate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody Mus musculus Ampicillin PMID:30667360 RRID: AB_2750765. Isotype: IgG2a. Additional species: rat, mouse. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
Anti-Kirrel3, short isoform 3 [N320/48R]
 
Resource Report
Resource Website 		RRID:Addgene_149452 anti-Kirrel3, short isoform 3 (Mus musculus) recombinant mouse monoclonal antibody Mus musculus Ampicillin PMID:30667360 RRID: AB_2750773. Isotype: IgG2a. Additional species: mouse. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
Anti-BK beta4 K+ channel [L18A/3R]
 
Resource Report
Resource Website 		RRID:Addgene_149454 anti-BK beta4 K+ channel (Mus musculus) recombinant mouse monoclonal antibody Mus musculus Ampicillin PMID:30667360 RRID: AB_2750681. Isotype: IgG2a. Additional species: human, mouse, rat. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
Anti-MMP9 matrix metalloproteinase-9 precursor [L51/82R]
 
Resource Report
Resource Website 		RRID:Addgene_149455 anti-MMP9 matrix metalloproteinase-9 precursor (Rattus norvegicus) recombinant mouse monoclonal antibody Mus musculus Ampicillin PMID:30667360 RRID: AB_2750689. Isotype: IgG2a. Additional species:human, mouse, rat. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
Anti-GABA(A)R, Alpha5 [N415/24R]
 
Resource Report
Resource Website 		RRID:Addgene_149456 anti-GABA(A)R, Alpha5 (Homo sapiens) recombinant mouse monoclonal antibody Mus musculus Ampicillin PMID:30667360 RRID: AB_2750794. Isotype: IgG2a. Additional species: humna, mouse, rat. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:49:28 0
pCHA1.1-Rap2a-V5
 
Resource Report
Resource Website 		RRID:Addgene_149509 RAP2 Homo sapiens Ampicillin PMID:33208952 Backbone Size:7994; Vector Backbone:pCHA1.1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin Codon Optimized Sequence 2026-09-05 12:49:29 0
pKAR5
 
Resource Report
Resource Website 		RRID:Addgene_149461 AraC-mRFP Synthetic Gentamicin PMID:34125913 Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin 2026-09-05 12:49:28 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch