Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107146 Copy
Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA
pLKO TRC v2 library vector, Puro selection and eGFP expression.
Proper citation: RRID:Addgene_107145 Copy
Species: Synthetic
Genetic Insert: ProA-RBS(B0032)-Gemini (E0051)
Vector Backbone Description: Backbone Marker:http://parts.igem.org/Part:pSB3C5; Backbone Size:2738; Vector Backbone:pSB3C5; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20843779
Proper citation: RRID:Addgene_107241 Copy
Genetic Insert: MARK3
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29431698
Comments: Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint.
Proper citation: RRID:Addgene_107235 Copy
Species: Homo sapiens
Genetic Insert: RB del22
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Comments: EcoRI is an internal site as well. See author's map. To learn more about del22 mutant, see reference: Sellers WR, Rodgers JW, and Kaelin WG, PNAS 92:11544.
Proper citation: RRID:Addgene_10721 Copy
Species: Homo sapiens
Genetic Insert: RB
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Proper citation: RRID:Addgene_10720 Copy
Species: Synthetic
Genetic Insert: ecAT3.10
Vector Backbone Description: Backbone Marker:modified from Invitrogen; Backbone Size:5000; Vector Backbone:pCMV(MinDis) [variant of pDisplay]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29121644
Proper citation: RRID:Addgene_107215 Copy
Species: Other
Genetic Insert: EF2132
Vector Backbone Description: Backbone Size:5750; Vector Backbone:pCN-50; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29463653
Proper citation: RRID:Addgene_107191 Copy
Species: Synthetic
Genetic Insert: 1D3-28Z. 1-3 mut
Vector Backbone Description: Backbone Size:5586; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20631379
Proper citation: RRID:Addgene_107227 Copy
Species: Synthetic
Genetic Insert: 1D3-28Z All ITAMs intact
Vector Backbone Description: Backbone Size:5584; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20631379
Proper citation: RRID:Addgene_107226 Copy
Genetic Insert: KKH SaCas9
Vector Backbone Description: Backbone Marker:Richard Sherwood Lab; Backbone Size:6637; Vector Backbone:p2T-CAG-MCS-BlastR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30405244
Proper citation: RRID:Addgene_107189 Copy
Species: Other
Genetic Insert: aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107313 Copy
Species: Other
Genetic Insert: EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Vector Backbone Description: Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107311 Copy
Species: Other
Genetic Insert: dSV40-dCas9-10xGCN4
Vector Backbone Description: Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107310 Copy
Species: S. aureus
Genetic Insert: SaCas9
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839
Proper citation: RRID:Addgene_107317 Copy
Species: Homo sapiens
Genetic Insert: RINS1
Vector Backbone Description: Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28366620
Proper citation: RRID:Addgene_107290 Copy
Species: Synthetic
Genetic Insert: SpCas9-SaCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839
Proper citation: RRID:Addgene_107320 Copy
Genetic Insert: RNA motif plasmid cloning backbone
Vector Backbone Description: Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29400715
Comments: Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs.
Oligo cloning can be performed similarly to sgRNA cloning. Primers to order:
Primers (5'->3')
F GCTT
Proper citation: RRID:Addgene_107253 Copy
Species: Homo sapiens
Genetic Insert: 6x Halo-EGFP- 2x PACT
Vector Backbone Description: Vector Backbone:pERB219; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097549
Proper citation: RRID:Addgene_107265 Copy
Genetic Insert: toehold 7 + sfGFP
Vector Backbone Description: Backbone Marker:New England Biolabs (cloning vector); Backbone Size:2202; Vector Backbone:pNP1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30083608
Proper citation: RRID:Addgene_107355 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.