Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 13 showing 241 ~ 260 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_107146

    This resource has 1+ mentions.

http://www.addgene.org/107146

Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107146 Copy   


  • RRID:Addgene_107145

    This resource has 10+ mentions.

http://www.addgene.org/107145

Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA pLKO TRC v2 library vector, Puro selection and eGFP expression.

Proper citation: RRID:Addgene_107145 Copy   


  • RRID:Addgene_107241

    This resource has 1+ mentions.

http://www.addgene.org/107241

Species: Synthetic
Genetic Insert: ProA-RBS(B0032)-Gemini (E0051)
Vector Backbone Description: Backbone Marker:http://parts.igem.org/Part:pSB3C5; Backbone Size:2738; Vector Backbone:pSB3C5; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20843779

Proper citation: RRID:Addgene_107241 Copy   


  • RRID:Addgene_107235

    This resource has 1+ mentions.

http://www.addgene.org/107235

Genetic Insert: MARK3
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29431698
Comments: Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint.

Proper citation: RRID:Addgene_107235 Copy   


  • RRID:Addgene_10721

    This resource has 1+ mentions.

http://www.addgene.org/10721

Species: Homo sapiens
Genetic Insert: RB del22
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Comments: EcoRI is an internal site as well. See author's map. To learn more about del22 mutant, see reference: Sellers WR, Rodgers JW, and Kaelin WG, PNAS 92:11544.

Proper citation: RRID:Addgene_10721 Copy   


  • RRID:Addgene_10720

    This resource has 10+ mentions.

http://www.addgene.org/10720

Species: Homo sapiens
Genetic Insert: RB
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334

Proper citation: RRID:Addgene_10720 Copy   


  • RRID:Addgene_107215

    This resource has 1+ mentions.

http://www.addgene.org/107215

Species: Synthetic
Genetic Insert: ecAT3.10
Vector Backbone Description: Backbone Marker:modified from Invitrogen; Backbone Size:5000; Vector Backbone:pCMV(MinDis) [variant of pDisplay]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29121644

Proper citation: RRID:Addgene_107215 Copy   


  • RRID:Addgene_107191

    This resource has 1+ mentions.

http://www.addgene.org/107191

Species: Other
Genetic Insert: EF2132
Vector Backbone Description: Backbone Size:5750; Vector Backbone:pCN-50; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29463653

Proper citation: RRID:Addgene_107191 Copy   


  • RRID:Addgene_107227

    This resource has 1+ mentions.

http://www.addgene.org/107227

Species: Synthetic
Genetic Insert: 1D3-28Z. 1-3 mut
Vector Backbone Description: Backbone Size:5586; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20631379

Proper citation: RRID:Addgene_107227 Copy   


http://www.addgene.org/107226

Species: Synthetic
Genetic Insert: 1D3-28Z All ITAMs intact
Vector Backbone Description: Backbone Size:5584; Vector Backbone:MSGV1; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20631379

Proper citation: RRID:Addgene_107226 Copy   


  • RRID:Addgene_107189

    This resource has 1+ mentions.

http://www.addgene.org/107189

Genetic Insert: KKH SaCas9
Vector Backbone Description: Backbone Marker:Richard Sherwood Lab; Backbone Size:6637; Vector Backbone:p2T-CAG-MCS-BlastR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30405244

Proper citation: RRID:Addgene_107189 Copy   


http://www.addgene.org/107313

Species: Other
Genetic Insert: aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603

Proper citation: RRID:Addgene_107313 Copy   


http://www.addgene.org/107311

Species: Other
Genetic Insert: EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Vector Backbone Description: Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603

Proper citation: RRID:Addgene_107311 Copy   


http://www.addgene.org/107310

Species: Other
Genetic Insert: dSV40-dCas9-10xGCN4
Vector Backbone Description: Vector Backbone:Lentivirus; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29335603

Proper citation: RRID:Addgene_107310 Copy   


http://www.addgene.org/107317

Species: S. aureus
Genetic Insert: SaCas9
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107317 Copy   


  • RRID:Addgene_107290

    This resource has 1+ mentions.

http://www.addgene.org/107290

Species: Homo sapiens
Genetic Insert: RINS1
Vector Backbone Description: Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28366620

Proper citation: RRID:Addgene_107290 Copy   


http://www.addgene.org/107320

Species: Synthetic
Genetic Insert: SpCas9-SaCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107320 Copy   


http://www.addgene.org/107253

Genetic Insert: RNA motif plasmid cloning backbone
Vector Backbone Description: Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29400715
Comments: Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs. Oligo cloning can be performed similarly to sgRNA cloning. Primers to order: Primers (5'->3') F GCTT R AGCT Example to clone in motif IRE motif IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA Primers to order F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA

Proper citation: RRID:Addgene_107253 Copy   


  • RRID:Addgene_107265

    This resource has 1+ mentions.

http://www.addgene.org/107265

Species: Homo sapiens
Genetic Insert: 6x Halo-EGFP- 2x PACT
Vector Backbone Description: Vector Backbone:pERB219; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097549

Proper citation: RRID:Addgene_107265 Copy   


  • RRID:Addgene_107355

    This resource has 1+ mentions.

http://www.addgene.org/107355

Genetic Insert: toehold 7 + sfGFP
Vector Backbone Description: Backbone Marker:New England Biolabs (cloning vector); Backbone Size:2202; Vector Backbone:pNP1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30083608

Proper citation: RRID:Addgene_107355 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X