Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: BBa_J23109-BBa_B0034-luxR-Terminator-pLux-BBa_B0034-GFP(LVA)-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78692 Copy
Species: Synthetic
Genetic Insert: BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0033-GFP(LVA)-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78699 Copy
Species: Synthetic
Genetic Insert: cytGAP
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24501126
Comments: GAP is a fusion of two Aequorea victoria proteins, GFP and apo-aequorin, with a linker in between. The excitation spectrum of GAP maintained the two peaks of wtGFP, at 403 and 470 nm, and it was sensitive to Ca2+.
Proper citation: RRID:Addgene_78734 Copy
Species: Synthetic
Genetic Insert: BBa_J23109-BBa_B0034-luxR-Terminator-pLux-BBa_B0033-GFP-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78695 Copy
Species: Synthetic
Genetic Insert: BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0034-GFP-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78697 Copy
Species: Synthetic
Genetic Insert: BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0034-GFP(LVA)-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78696 Copy
Species: Synthetic
Genetic Insert: tgoGAP1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24501126
Proper citation: RRID:Addgene_78737 Copy
Species: Synthetic
Genetic Insert: Insulated pTet Promoter
Vector Backbone Description: Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28422998
Proper citation: RRID:Addgene_78680 Copy
Species: Synthetic
Genetic Insert: SV40-CMV-SaCas9-3xNLS
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686
Proper citation: RRID:Addgene_78601 Copy
Species: Synthetic
Genetic Insert: U6-SpAi9L-U6SpDMDL
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR blunt II TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26721686
Proper citation: RRID:Addgene_78608 Copy
Species: Synthetic
Genetic Insert: U6-SpAi9R-U6-SpDMDR
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR blunt II TOPO; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26721686
Proper citation: RRID:Addgene_78609 Copy
Species: Synthetic
Genetic Insert: gRNAs for SaCas9 targeting Ai9 locus
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686
Proper citation: RRID:Addgene_78604 Copy
Species: Synthetic
Genetic Insert: CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686
Comments: gRNA targeting sequences:
CAGTAATGTGTCATACCTTC;
ATATAATAGAAATTATTCAT
Proper citation: RRID:Addgene_78606 Copy
Species: Synthetic
Genetic Insert: J101-rbs32-arsR-t-ParsR
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78635 Copy
Species: Synthetic
Genetic Insert: 30hrpR-32hrpS-t-hrpL-30gfp-t
Vector Backbone Description: Backbone Marker:Wang Lab; Vector Backbone:pBW100ParsR; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78637 Copy
Species: Synthetic
Genetic Insert: araC-PBAD
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78639 Copy
Species: Synthetic
Genetic Insert: LbCpf1 crRNA backbone, without spacer sequence
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 43860); Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27347757
Comments: Use BsmBI sites to insert crRNA spacer sequence into the vector. This plasmid will express gRNA in mammalian cells for Cpf1 from Lachnospiraceae bacterium ND2006. Recommended to use with SQT1665 (Addgene plasmid# 78744), which expresses Lachnospiraceae bacterium ND2006 Cpf1.
Please visit https://www.biorxiv.org/content/early/2016/06/09/057802 for bioRxiv preprint.
Proper citation: RRID:Addgene_78742 Copy
Species: Synthetic
Genetic Insert: J106-30hrpR-32hrpS-t-hrpL-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78651 Copy
Species: Synthetic
Genetic Insert: J105-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78644 Copy
Species: Synthetic
Genetic Insert: J106-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78645 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.