Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pENTR-AIF Resource Report Resource Website 1+ mentions |
RRID:Addgene_16182 | Apoptosis-inducing factor | Homo sapiens | Spectinomycin | PMID:16713569 | Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGTTCCGGTGTGGAGGCC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG GTCTTCATGAATGTTGAATAGTT-3'. | Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin | 2026-09-01 09:26:04 | 2 | |
|
pENTR-PPP2R2B Resource Report Resource Website 1+ mentions |
RRID:Addgene_16181 | PP2A regulatory subunit B, beta isoform | Homo sapiens | Spectinomycin | PMID:16713569 | Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGGAGGAGGACATTGATACC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG GTTAACCTTGTCCTGGAATATA-3'. | Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin | 2026-09-01 09:26:03 | 1 | |
|
pENTR-PKCG Resource Report Resource Website 1+ mentions |
RRID:Addgene_16180 | PRKC gamma | Homo sapiens | Spectinomycin | PMID:16713569 | Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGGCTGGTCTGGGCCCC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG CATGACGGGCACAGGCACT-3'. | Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin | 2026-09-01 09:26:03 | 1 | |
|
IDG_KCNN1_OE_1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_161693 | KCNN1 | Homo sapiens | Ampicillin | Vector Backbone:pLX304; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:02 | 1 | |||
|
pINDUCER20_mStrawberry_Atg4BC74A Resource Report Resource Website 1+ mentions |
RRID:Addgene_161735 | Atg4B(C74A) (Atg4b Mouse) | Mus musculus | Ampicillin | PMID:32376951 | Backbone Marker:Addgene #44012; Vector Backbone:pINDUCER20; Vector Types:Mammalian Expression, Lentiviral, destinatioin vector for gateway cloning; Bacterial Resistance:Ampicillin | 220-222 TGC (Cys) is changed to GCA (Ala) | 2026-09-01 09:26:02 | 1 | |
|
pJT039 AAVS1-PuroR-9xTet0-pEF-IGKleader-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA Resource Report Resource Website 1+ mentions |
RRID:Addgene_161927 | Surface marker and Citrine repression reporter | Other | Ampicillin | PMID:33326746 | Cloned with reagents shared by and in collaboration with Michael Bassik. | Vector Backbone:pAAVS1 donor; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:05 | 3 | |
|
pDest-667 (attR4-attR3) Resource Report Resource Website 1+ mentions |
RRID:Addgene_161886 | Chloramphenicol and Ampicillin | PMID:24395366 | Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:26:04 | 1 | ||||
|
pDest-686 (attR4-attR2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_161889 | Chloramphenicol and Ampicillin | PMID:24395366 | Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:26:04 | 1 | ||||
|
INPP5D-eGFP WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_161998 | INPP5D | Homo sapiens | Kanamycin | PMID:30487552 | Vector Backbone:eGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:26:06 | 1 | ||
|
pcDNA3.1-mGreenLantern Resource Report Resource Website 10+ mentions |
RRID:Addgene_161912 | mGreenLantern | Synthetic | Ampicillin | PMID:33208539 | Backbone Size:5410; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:04 | 13 | ||
|
pBSc polyA + Shal1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_16196 | Drosophila melanogaster Shaker cognate l | Drosophila melanogaster | Ampicillin | PMID:2333511 | Backbone Size:3200; Vector Backbone:pBSc; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin | N/A | 2026-09-01 09:26:05 | 1 | |
|
pEC1.2/EC1.1_spCas9_GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_161933 | Kanamycin | Backbone Size:16255; Vector Backbone:pHEE401E; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-09-01 09:26:05 | 1 | |||||
|
pOX + nSlo2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_16202 | Caenorhabditis elegans SLOwpoke potassium channel | Caenorhabditis elegans | Ampicillin | PMID:10903569 | Backbone Size:3200; Vector Backbone:pOX; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin | N/A | 2026-09-01 09:26:06 | 1 | |
|
pMSR0 Resource Report Resource Website 1+ mentions |
RRID:Addgene_161984 | Chloramphenicol | PMID:33247281 | Please note Addgene NGS result identified a mismatch in pBP1_RepA. Depositor has not confirmed if this is a concern for plasmid function. We recommend additional QC to confirm plasmid is functional. | Backbone Size:6696; Vector Backbone:pMSR0; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-01 09:26:05 | 1 | |||
|
GFP-PH-TAPP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_161985 | PH-TAPP1 | Homo sapiens | Kanamycin | PMID:23823722 | Vector Backbone:eGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:26:05 | 2 | ||
|
GFP-PIK3C2B Resource Report Resource Website 1+ mentions |
RRID:Addgene_161989 | PIK3C2B | Homo sapiens | Ampicillin | PMID:28572395 | This plasmid has also been described in: Wallroth, A., Koch, P.A., Marat, A.L., Krause, E., Haucke, V. (2019) Protein kinase N controls a lysosomal lipid switch to facilitate nutrient signaling via mTORC1. Nature Cell Biol. 21, 1093-1101. doi: 10.1038/s41556-019-0377-3 | Vector Backbone:eGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | siRNA resistance to siRNA#2 with 4 silent mutations: 5’- GCTACCAGTTACGAGGACT-3’. | 2026-09-01 09:26:06 | 1 |
|
pML104-natR412 Resource Report Resource Website 1+ mentions |
RRID:Addgene_162042 | natR412 guide | Synthetic | Ampicillin | PMID:34042294 | This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: GTACCGCACCAGTGTCCCGG | Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:07 | 1 | |
|
pKRG3-mU6-PUb-hSpCas9-pAc Resource Report Resource Website 1+ mentions |
RRID:Addgene_162163 | hSpCas9 | Synthetic | Ampicillin | PMID:33436886 | https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1 | Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:08 | 1 | |
|
pML107-kanR468 Resource Report Resource Website 1+ mentions |
RRID:Addgene_162041 | kanR468 guide | Synthetic | Ampicillin | PMID:34042294 | This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: TCCATGTTGGAATTTAATCG | Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:07 | 1 | |
|
pKRG3-mU6-PUb-3xFLAG-hSpCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_162161 | hSpCas9 | Synthetic | Ampicillin | PMID:33436886 | https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1 | Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:26:08 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.