Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pENTR-AIF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16182 Apoptosis-inducing factor Homo sapiens Spectinomycin PMID:16713569 Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGTTCCGGTGTGGAGGCC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG GTCTTCATGAATGTTGAATAGTT-3'. Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin 2026-09-01 09:26:04 2
pENTR-PPP2R2B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16181 PP2A regulatory subunit B, beta isoform Homo sapiens Spectinomycin PMID:16713569 Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGGAGGAGGACATTGATACC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG GTTAACCTTGTCCTGGAATATA-3'. Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin 2026-09-01 09:26:03 1
pENTR-PKCG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16180 PRKC gamma Homo sapiens Spectinomycin PMID:16713569 Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGGCTGGTCTGGGCCCC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG CATGACGGGCACAGGCACT-3'. Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin 2026-09-01 09:26:03 1
IDG_KCNN1_OE_1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161693 KCNN1 Homo sapiens Ampicillin Vector Backbone:pLX304; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:26:02 1
pINDUCER20_mStrawberry_Atg4BC74A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161735 Atg4B(C74A) (Atg4b Mouse) Mus musculus Ampicillin PMID:32376951 Backbone Marker:Addgene #44012; Vector Backbone:pINDUCER20; Vector Types:Mammalian Expression, Lentiviral, destinatioin vector for gateway cloning; Bacterial Resistance:Ampicillin 220-222 TGC (Cys) is changed to GCA (Ala) 2026-09-01 09:26:02 1
pJT039 AAVS1-PuroR-9xTet0-pEF-IGKleader-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161927 Surface marker and Citrine repression reporter Other Ampicillin PMID:33326746 Cloned with reagents shared by and in collaboration with Michael Bassik. Vector Backbone:pAAVS1 donor; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:26:05 3
pDest-667 (attR4-attR3)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161886 Chloramphenicol and Ampicillin PMID:24395366 Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-09-01 09:26:04 1
pDest-686 (attR4-attR2)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161889 Chloramphenicol and Ampicillin PMID:24395366 Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-09-01 09:26:04 1
INPP5D-eGFP WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161998 INPP5D Homo sapiens Kanamycin PMID:30487552 Vector Backbone:eGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:26:06 1
pcDNA3.1-mGreenLantern
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_161912 mGreenLantern Synthetic Ampicillin PMID:33208539 Backbone Size:5410; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:26:04 13
pBSc polyA + Shal1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16196 Drosophila melanogaster Shaker cognate l Drosophila melanogaster Ampicillin PMID:2333511 Backbone Size:3200; Vector Backbone:pBSc; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin N/A 2026-09-01 09:26:05 1
pEC1.2/EC1.1_spCas9_GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161933 Kanamycin Backbone Size:16255; Vector Backbone:pHEE401E; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 09:26:05 1
pOX + nSlo2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16202 Caenorhabditis elegans SLOwpoke potassium channel Caenorhabditis elegans Ampicillin PMID:10903569 Backbone Size:3200; Vector Backbone:pOX; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin N/A 2026-09-01 09:26:06 1
pMSR0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161984 Chloramphenicol PMID:33247281 Please note Addgene NGS result identified a mismatch in pBP1_RepA. Depositor has not confirmed if this is a concern for plasmid function. We recommend additional QC to confirm plasmid is functional. Backbone Size:6696; Vector Backbone:pMSR0; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-01 09:26:05 1
GFP-PH-TAPP1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161985 PH-TAPP1 Homo sapiens Kanamycin PMID:23823722 Vector Backbone:eGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:26:05 2
GFP-PIK3C2B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161989 PIK3C2B Homo sapiens Ampicillin PMID:28572395 This plasmid has also been described in: Wallroth, A., Koch, P.A., Marat, A.L., Krause, E., Haucke, V. (2019) Protein kinase N controls a lysosomal lipid switch to facilitate nutrient signaling via mTORC1. Nature Cell Biol. 21, 1093-1101. doi: 10.1038/s41556-019-0377-3 Vector Backbone:eGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin siRNA resistance to siRNA#2 with 4 silent mutations: 5’- GCTACCAGTTACGAGGACT-3’. 2026-09-01 09:26:06 1
pML104-natR412
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_162042 natR412 guide Synthetic Ampicillin PMID:34042294 This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: GTACCGCACCAGTGTCCCGG Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:26:07 1
pKRG3-mU6-PUb-hSpCas9-pAc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_162163 hSpCas9 Synthetic Ampicillin PMID:33436886 https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1 Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:26:08 1
pML107-kanR468
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_162041 kanR468 guide Synthetic Ampicillin PMID:34042294 This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: TCCATGTTGGAATTTAATCG Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:26:07 1
pKRG3-mU6-PUb-3xFLAG-hSpCas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_162161 hSpCas9 Synthetic Ampicillin PMID:33436886 https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1 Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:26:08 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch