Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:synthetic (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

30,615 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pWPT-/UAA-mEGFP-IRES-mCherry
 
Resource Report
Resource Website
RRID:Addgene_49234 mEGFP Synthetic Ampicillin PMID:23798422 Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream. Backbone Size:8754; Vector Backbone:Plasmid 12255: pWPT-GFP; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:56:07 0
pWPT-UCU/ACC-mEGFP-IRES-mCherry
 
Resource Report
Resource Website
RRID:Addgene_49232 mEGFP Synthetic Ampicillin PMID:23798422 Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream. Backbone Size:8754; Vector Backbone:Plasmid 12255: pWPT-GFP; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:56:07 0
pCru5-/GCCACC-mEGFP-IRES-mCherry
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49226 mEGFP Synthetic Ampicillin PMID:23798422 Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream. Vector Backbone:pCru5; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:56:07 1
pAc-y1sgRNA-Cas9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49331 Cas9 Synthetic Ampicillin PMID:24326186 gRNA target sequence GGTTTTGGACACTGGAACCG Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin Human codon optimised 2026-09-01 09:56:09 4
pCAG-GBP7-p65AD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49441 GBP7-p65 transactivation domain fusion protein Synthetic Ampicillin PMID:23953120 Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:56:10 1
GPD-roGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49436 GPD-roGFP2 Synthetic Ampicillin PMID:20019331 Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin C48S, Q80R, S147C, and Q204C in Clontech's GFP 2026-09-01 09:56:10 4
Cyto-roGFP
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_49435 roGFP2 Synthetic Ampicillin PMID:20019331 Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin C48S, Q80R, S147C, and Q204C in Clontech's GFP 2026-09-01 09:56:10 19
pCAG-Gal4DBD-GBP2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49439 GBP2-Gal4 DNA binding domain fusion protein Synthetic Ampicillin PMID:23953120 Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:56:10 2
pCAG-GBP1-10gly-Gal4DBD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49438 GBP1-Gal4 DNA binding domain fusion protein Synthetic Ampicillin PMID:23953120 The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility. Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C98S (to increase protein solubility), Q3D 2026-09-01 09:56:10 5
pMPRAdonor1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49352 luc2 Synthetic Ampicillin PMID:25177895 Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-09-01 09:56:09 1
pMPRAdonor2
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_49353 luc2 Synthetic Ampicillin PMID:25177895 Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-09-01 09:56:09 13
pT7CFE1-TelR15-YPet
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49646 TelR15 Synthetic Ampicillin PMID:24324157 Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin 2026-09-01 09:56:11 1
pT7CFE1-TelR15-sfGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49645 TelR15 Synthetic Ampicillin PMID:24324157 Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin 2026-09-01 09:56:11 1
pT7CFE1-TelR15-mTagBFP2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49643 TelR15 Synthetic Ampicillin PMID:24324157 Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin 2026-09-01 09:56:11 1
pT7CFE1-TelR15-mCherry
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49647 TelR15 Synthetic Ampicillin PMID:24324157 Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin 2026-09-01 09:56:11 1
pVRb18_up1700
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49712 sfgfp Synthetic Kanamycin PMID:24169405 Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-01 09:56:12 1
pVRb17_up1691
 
Resource Report
Resource Website
RRID:Addgene_49711 sfgfp Synthetic Kanamycin PMID:24169405 Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-01 09:56:12 0
pVRb16_3622
 
Resource Report
Resource Website
RRID:Addgene_49710 sfgfp Synthetic Kanamycin PMID:24169405 Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-01 09:56:12 0
pVRb19_up1315
 
Resource Report
Resource Website
RRID:Addgene_49713 sfgfp Synthetic Kanamycin PMID:24169405 Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-01 09:56:12 0
pICH41308::hCas9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49770 hCas9 Synthetic Spectinomycin PMID:24112467 BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis, however the amino acid sequence is as in the original hCas9. Vector Backbone:pICH41308; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin 2026-09-01 09:56:13 4

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.