Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGCCACAAGTTCAGCGTGTC
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51762 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGAGCGCACCATCTTCTTCA
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51763 Copy
Species: Synthetic
Genetic Insert: Sirius
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19349978
Comments: GenBank accession number: AB444952
Proper citation: RRID:Addgene_51957 Copy
Species: Synthetic
Genetic Insert: Sirius
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19349978
Comments: GenBank accession number: AB444952
Proper citation: RRID:Addgene_51956 Copy
Species: Synthetic
Genetic Insert: ATeam1.03-nD/nA
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20047338
Proper citation: RRID:Addgene_51959 Copy
Species: Synthetic
Genetic Insert: ATeam1.03-nD/nA
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20047338
Proper citation: RRID:Addgene_51960 Copy
Species: Synthetic
Genetic Insert: Yellow Cameleon-Nano140
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20693999
Comments: GenBank accession number: HM145949
Proper citation: RRID:Addgene_51966 Copy
Species: Synthetic
Genetic Insert: Yellow Cameleon-Nano15
Vector Backbone Description: Vector Backbone:pBig delta BamHI; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20693999
Comments: The vector pBIG is derived from the published construct pATANB43 (Dynes and Firtel, 1989). pBIG contains a 5.9 kb fragment of the native Dictyostelium extrachromosomal plasmid Ddpl that confers autonomous replication in Dictyostelium, a 2.2 kb actm 6 promoter-G418-resistant gene cartridge, and vector sequences from pBluescript (11) SK (Stratagene). (reference: Cell, Vol 75, Issue 2, 1993, 361-371).
Proper citation: RRID:Addgene_51962 Copy
Species: Synthetic
Genetic Insert: Yellow Cameleon-Nano15
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20693999
Comments: GenBank accession number: GU071083
The minor discrepancies between the QC and depositor sequence have no functional consequence.
Proper citation: RRID:Addgene_51961 Copy
Species: Synthetic
Genetic Insert: Yellow Cameleon-Nano30
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20693999
Comments: GenBank accession number: GU071084
Proper citation: RRID:Addgene_51963 Copy
Species: Synthetic
Genetic Insert: Nano-lantern
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859492. The improved brightness of Nano-lantern should generate power densities in the range of 1μW/cm2 (versus 0.1μW/cm2 for RLuc8) following transient overexpression in the micromolar range in human cells, and thus increase imaging potential.
Proper citation: RRID:Addgene_51969 Copy
Species: Synthetic
Genetic Insert: Nano-lantern
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859492
The minor discrepancies between the QC and depositor sequence have no functional consequence.
Proper citation: RRID:Addgene_51971 Copy
Species: Synthetic
Genetic Insert: Nano-lantern_CaM-2GS
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859494
Proper citation: RRID:Addgene_51979 Copy
Species: Synthetic
Genetic Insert: Nano-lantern
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859492
Proper citation: RRID:Addgene_51972 Copy
Species: Synthetic
Genetic Insert: Nano-lantern
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859492
The minor discrepancies between the QC and depositor sequence have no functional consequence and Addgene's QC sequence should be used for comparison.
Please note the upstream KpnI site shown on the depositor's map is not present in this plasmid.
Proper citation: RRID:Addgene_51975 Copy
Species: Synthetic
Genetic Insert: Nano-lantern_CaM_E104Q-4GS
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859498
Proper citation: RRID:Addgene_51980 Copy
Species: Synthetic
Genetic Insert: Nano-lantern_CaM_E104Q-2G
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859496
The minor discrepancies between the QC and depositor sequence have no functional consequence.
Proper citation: RRID:Addgene_51982 Copy
Species: Synthetic
Genetic Insert: Nano-lantern_CaM-4GS
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859495
Proper citation: RRID:Addgene_51981 Copy
Species: Synthetic
Genetic Insert: Nano-lantern_ATP0
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN974906. Although they differ by only three N-terminal amino acidsin the RLuc8-S257G moiety, their dynamic range and brightness were vastly different. Nano-lantern (ATP1) exhibited enough dynamic range (200%) for functional imaging, and was 1.5-fold brighter than Nano-lantern (ATP0) at ATP-saturating condition. They had similar affinities for ATP.
Proper citation: RRID:Addgene_51989 Copy
Species: Synthetic
Genetic Insert: Nano-lantern_CaM_E104Q-3GS
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859497
The minor discrepancies between the QC and depositor sequence have no functional consequence.
Proper citation: RRID:Addgene_51983 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.