Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 111 showing 2201 ~ 2220 out of 30,615 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/49232

Species: Synthetic
Genetic Insert: mEGFP
Vector Backbone Description: Backbone Size:8754; Vector Backbone:Plasmid 12255: pWPT-GFP; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23798422
Comments: Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.

Proper citation: RRID:Addgene_49232 Copy   


http://www.addgene.org/49226

Species: Synthetic
Genetic Insert: mEGFP
Vector Backbone Description: Vector Backbone:pCru5; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23798422
Comments: Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.

Proper citation: RRID:Addgene_49226 Copy   


  • RRID:Addgene_49331

    This resource has 1+ mentions.

http://www.addgene.org/49331

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG

Proper citation: RRID:Addgene_49331 Copy   


  • RRID:Addgene_49441

    This resource has 1+ mentions.

http://www.addgene.org/49441

Species: Synthetic
Genetic Insert: GBP7-p65 transactivation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Proper citation: RRID:Addgene_49441 Copy   


  • RRID:Addgene_49436

    This resource has 1+ mentions.

http://www.addgene.org/49436

Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331

Proper citation: RRID:Addgene_49436 Copy   


  • RRID:Addgene_49435

    This resource has 10+ mentions.

http://www.addgene.org/49435

Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331

Proper citation: RRID:Addgene_49435 Copy   


  • RRID:Addgene_49439

    This resource has 1+ mentions.

http://www.addgene.org/49439

Species: Synthetic
Genetic Insert: GBP2-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Proper citation: RRID:Addgene_49439 Copy   


  • RRID:Addgene_49438

    This resource has 1+ mentions.

http://www.addgene.org/49438

Species: Synthetic
Genetic Insert: GBP1-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility. Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Proper citation: RRID:Addgene_49438 Copy   


  • RRID:Addgene_49352

    This resource has 1+ mentions.

http://www.addgene.org/49352

Species: Synthetic
Genetic Insert: luc2
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895

Proper citation: RRID:Addgene_49352 Copy   


  • RRID:Addgene_49353

    This resource has 10+ mentions.

http://www.addgene.org/49353

Species: Synthetic
Genetic Insert: luc2
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895

Proper citation: RRID:Addgene_49353 Copy   


  • RRID:Addgene_49646

    This resource has 1+ mentions.

http://www.addgene.org/49646

Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157

Proper citation: RRID:Addgene_49646 Copy   


  • RRID:Addgene_49645

    This resource has 1+ mentions.

http://www.addgene.org/49645

Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157

Proper citation: RRID:Addgene_49645 Copy   


  • RRID:Addgene_49643

    This resource has 1+ mentions.

http://www.addgene.org/49643

Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157

Proper citation: RRID:Addgene_49643 Copy   


  • RRID:Addgene_49647

    This resource has 1+ mentions.

http://www.addgene.org/49647

Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157

Proper citation: RRID:Addgene_49647 Copy   


  • RRID:Addgene_49712

    This resource has 1+ mentions.

http://www.addgene.org/49712

Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405

Proper citation: RRID:Addgene_49712 Copy   


  • RRID:Addgene_49711

http://www.addgene.org/49711

Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405

Proper citation: RRID:Addgene_49711 Copy   


  • RRID:Addgene_49710

http://www.addgene.org/49710

Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405

Proper citation: RRID:Addgene_49710 Copy   


  • RRID:Addgene_49713

http://www.addgene.org/49713

Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405

Proper citation: RRID:Addgene_49713 Copy   


  • RRID:Addgene_49770

    This resource has 1+ mentions.

http://www.addgene.org/49770

Species: Synthetic
Genetic Insert: hCas9
Vector Backbone Description: Vector Backbone:pICH41308; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24112467
Comments: BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis, however the amino acid sequence is as in the original hCas9.

Proper citation: RRID:Addgene_49770 Copy   


http://www.addgene.org/49772

Species: Synthetic
Genetic Insert: sgRNA_PDS2-Cas9-sgRNA_PDS1
Vector Backbone Description: Vector Backbone:pAGM4723; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24112467
Comments: We removed BsaI and BbsI sites from hCas9 preserving the amino acid composition. The construct was assembled using the Golden Gate system from S. Marillonnet.

Proper citation: RRID:Addgene_49772 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X