Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:synthetic (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

30,615 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
AmCyan-P2A-Xerry
 
Resource Report
Resource Website
RRID:Addgene_48686 AmCyan Synthetic Kanamycin the nAmCyan and the mCherry genes are separated by a P2A sequence that results in 2 separate proteins. It also includes BsmBI restriction sites flanking the nAmCyan gene which result in BsiWI and BssHII overhangs for cloning in-frame with P2A-mCherry. Backbone Marker:clontech; Backbone Size:4000; Vector Backbone:pmR-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin SV40 NLS 2026-09-01 09:56:00 0
pFUSB4_TGTC
 
Resource Report
Resource Website
RRID:Addgene_48605 RVD sequence: NG NN NG HD Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-09-01 09:55:59 0
pFUSB4_TGTA
 
Resource Report
Resource Website
RRID:Addgene_48604 RVD sequence: NG NN NG NI Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-09-01 09:55:59 0
pFUSB4_TGGG
 
Resource Report
Resource Website
RRID:Addgene_48602 RVD sequence: NG NN NN NN Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-09-01 09:55:59 0
M-tdTom-SP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48677 TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 Synthetic Bleocin (Zeocin) PMID:24076762 Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) 2026-09-01 09:56:00 2
M-ST1-sgRNA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48672 sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter Synthetic Kanamycin PMID:24076762 Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 09:56:00 4
SK-YFP-TD-A
 
Resource Report
Resource Website
RRID:Addgene_48666 TD prototspacer A/PAM with reporter EYFP Synthetic Kanamycin PMID:24076762 Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 09:56:00 0
SK-YFP-NM-A
 
Resource Report
Resource Website
RRID:Addgene_48664 NM prototspacer A/PAM with reporter EYFP Synthetic Kanamycin PMID:24076762 Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 09:56:00 0
SK-YFP-TD-B
 
Resource Report
Resource Website
RRID:Addgene_48663 TD prototspacer B/PAM with reporter EYFP Synthetic Kanamycin PMID:24076762 Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 09:56:00 0
SK-YFP-SPNM-B
 
Resource Report
Resource Website
RRID:Addgene_48661 SP/NM prototspacer B/PAM with reporter EYFP Synthetic Kanamycin PMID:24076762 Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-01 09:56:00 0
PM-TD!TB
 
Resource Report
Resource Website
RRID:Addgene_48656 Bacterial TD crRNA to prototspacer B Synthetic Chloramphenicol PMID:24076762 Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol 2026-09-01 09:55:59 0
PM-TD!TA
 
Resource Report
Resource Website
RRID:Addgene_48655 Bacterial TD crRNA to prototspacer A Synthetic Chloramphenicol PMID:24076762 Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol 2026-09-01 09:55:59 0
PM-ST1!TB
 
Resource Report
Resource Website
RRID:Addgene_48654 Bacterial ST1 crRNA to prototspacer B Synthetic Chloramphenicol PMID:24076762 Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol 2026-09-01 09:55:59 0
PM-SP!TA
 
Resource Report
Resource Website
RRID:Addgene_48649 Bacterial SP crRNA to prototspacer A Synthetic Chloramphenicol PMID:24076762 Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol 2026-09-01 09:55:59 0
pPy-CAG-GFP-IRES-Pac
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48759 EGFP Synthetic Ampicillin PMID:23582324 Backbone Size:6600; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, pPy; Bacterial Resistance:Ampicillin 2026-09-01 09:56:01 1
pGGD005
 
Resource Report
Resource Website
RRID:Addgene_48853 Linker:BFP Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp linker-BFP = 2252-3066bp BsaI site #2 = 3067-3077bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-09-01 09:56:02 0
pGGG002
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48851 H-A adapter - short Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp H-A adapter = 2252-2271bp BsaI site #2 = 2272-2282bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-09-01 09:56:02 1
pGGG001
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48850 F-H adapter - short Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp F-H adapter = 2252-2271bp BsaI site #2 = 2272-2282bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-09-01 09:56:02 1
pGGF012
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48849 pMAS::SulfadiazineR::t35S Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp Sulfadiazine resistance cassette with MAS promoter and 35S terminator = 2252-3882bp BsaI site #2 = 3883-3893bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin internal BsaI recognition sites in SulfR removed by silent substitutions 2026-09-01 09:56:02 1
pGGF008
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48848 pNOS::BastaR::tNOS Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BASTA resistance cassette with NOS promoter and terminator = 2252-3334bp BsaI site #2 = 3335-3345bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin chi sequence in BastaR removed by silent substitution 2026-09-01 09:56:02 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.