Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: AmCyan
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4000; Vector Backbone:pmR-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: the nAmCyan and the mCherry genes are separated by a P2A sequence that results in 2 separate proteins. It also includes BsmBI restriction sites flanking the nAmCyan gene which result in BsiWI and BssHII overhangs for cloning in-frame with P2A-mCherry.
Proper citation: RRID:Addgene_48686 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NG NN NG HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48605 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NG NN NG NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48604 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NG NN NN NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48602 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48677 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48672 Copy
Species: Synthetic
Genetic Insert: TD prototspacer A/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48666 Copy
Species: Synthetic
Genetic Insert: NM prototspacer A/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48664 Copy
Species: Synthetic
Genetic Insert: TD prototspacer B/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48663 Copy
Species: Synthetic
Genetic Insert: SP/NM prototspacer B/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48661 Copy
Species: Synthetic
Genetic Insert: Bacterial TD crRNA to prototspacer B
Vector Backbone Description: Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48656 Copy
Species: Synthetic
Genetic Insert: Bacterial TD crRNA to prototspacer A
Vector Backbone Description: Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48655 Copy
Species: Synthetic
Genetic Insert: Bacterial ST1 crRNA to prototspacer B
Vector Backbone Description: Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48654 Copy
Species: Synthetic
Genetic Insert: Bacterial SP crRNA to prototspacer A
Vector Backbone Description: Vector Backbone:p15A-cat; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48649 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:6600; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, pPy; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23582324
Proper citation: RRID:Addgene_48759 Copy
Species: Synthetic
Genetic Insert: Linker:BFP
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2251bp
linker-BFP = 2252-3066bp
BsaI site #2 = 3067-3077bp
Proper citation: RRID:Addgene_48853 Copy
Species: Synthetic
Genetic Insert: H-A adapter - short
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2251bp
H-A adapter = 2252-2271bp
BsaI site #2 = 2272-2282bp
Proper citation: RRID:Addgene_48851 Copy
Species: Synthetic
Genetic Insert: F-H adapter - short
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2251bp
F-H adapter = 2252-2271bp
BsaI site #2 = 2272-2282bp
Proper citation: RRID:Addgene_48850 Copy
Species: Synthetic
Genetic Insert: pMAS::SulfadiazineR::t35S
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2251bp
Sulfadiazine resistance cassette with MAS promoter and 35S terminator = 2252-3882bp
BsaI site #2 = 3883-3893bp
Proper citation: RRID:Addgene_48849 Copy
Species: Synthetic
Genetic Insert: pNOS::BastaR::tNOS
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme.
Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2251bp
BASTA resistance cassette with NOS promoter and terminator = 2252-3334bp
BsaI site #2 = 3335-3345bp
Proper citation: RRID:Addgene_48848 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.