Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:arabidopsis thaliana (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,249 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pRS300
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22846 MIR319a Arabidopsis thaliana Ampicillin PMID:16531494 See http://wmd3.weigelworld.org/ for more information Backbone Size:2964; Vector Backbone:pBluescriptSK+; Vector Types:Plant Expression, RNAi, Plant gene inactivation; Bacterial Resistance:Ampicillin 2026-09-05 12:54:04 10
pETM6-At4CL-CmCHS-MsCHI
 
Resource Report
Resource Website 		RRID:Addgene_73394 At4CL Arabidopsis thaliana Ampicillin PMID:26860871 Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-05 01:00:53 0
pETM6-At4CL-PhCHS-MsCHI
 
Resource Report
Resource Website 		RRID:Addgene_73392 At4CL Arabidopsis thaliana Ampicillin PMID:26860871 Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-05 01:00:53 0
PhyB-mCherry-Tom7
 
Resource Report
Resource Website 		RRID:Addgene_66571 PhyB Arabidopsis thaliana Ampicillin PMID:26035630 Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin PhyB portion contains aa's 1-908 2026-09-05 12:59:51 0
JW617
 
Resource Report
Resource Website 		RRID:Addgene_64809 CUC3 Arabidopsis thaliana Kanamycin PMID:25448000 Vector Backbone:pGBKT7; Vector Types:; Bacterial Resistance:Kanamycin 2026-09-05 12:59:33 0
JW790
 
Resource Report
Resource Website 		RRID:Addgene_64813 TCP4 Arabidopsis thaliana Kanamycin PMID:23555288 Vector Backbone:JW771 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin rTCP4 2026-09-05 12:59:34 0
pIR195
 
Resource Report
Resource Website 		RRID:Addgene_64810 TCP4 Arabidopsis thaliana Ampicillin PMID:25448000 Vector Backbone:pYES-DEST52; Vector Types:; Bacterial Resistance:Ampicillin 2026-09-05 12:59:33 0
pIR190
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_64812 TCP4 Arabidopsis thaliana Ampicillin PMID:23555288 Vector Backbone:pDEST22; Vector Types:; Bacterial Resistance:Ampicillin 2026-09-05 12:59:33 2
pIR197
 
Resource Report
Resource Website 		RRID:Addgene_64819 CUC2 Arabidopsis thaliana Kanamycin PMID:25448000 Vector Backbone:JW772 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin rCUC2 2026-09-05 12:59:34 0
pWY82
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_65721 Telomere Arabidopsis thaliana Spectinomycin and Streptomycin PMID:17085598 Please note that Addgene NGS found a 1.5kb deletion in the telomere repeats as compared to the original depositor sequence. The depositor has confirmed that the telomere sequence in the plasmid is inherently unstable, and that the plasmid is still functional for telomere truncation. The plasmid was also verified by restriction digest. The gel image is provided on this page under- Resource Information- Addgene Notes. Backbone Size:9189; Vector Backbone:pTF101.1; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin 2026-09-05 12:59:42 3
pJW1354
 
Resource Report
Resource Website 		RRID:Addgene_69490 GSGGGG spacer-Degron-TEV protease site-3x FLAG epitope Arabidopsis thaliana Kanamycin PMID:26552885 Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, template to generate cassettes for -mediated knock-in; Bacterial Resistance:Kanamycin 2026-09-05 01:00:15 0
Cry2 mCherry GRK2 ct in pcDNA3.1
 
Resource Report
Resource Website 		RRID:Addgene_64212 Cry2 PHR Arabidopsis thaliana Ampicillin PMID:24920824 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:59:29 0
Cry2 mCherry GRK3 ct in pcDNA3.1
 
Resource Report
Resource Website 		RRID:Addgene_64213 Cry2 PHR Arabidopsis thaliana Ampicillin PMID:24920824 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:59:29 0
pMAL-PIAL2M-sim1
 
Resource Report
Resource Website 		RRID:Addgene_67908 PIAL2 Arabidopsis thaliana Ampicillin PMID:25415977 Backbone Marker:NEB; Backbone Size:6700; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin E281-A496; VEDL 425-428 AAA 2026-09-05 01:00:02 0
pABD933
 
Resource Report
Resource Website 		RRID:Addgene_67917 CTG10 Arabidopsis thaliana Kanamycin PMID:29632208 Backbone Marker:Invitrogen; life technologies Thermo Fisher Scientific; Backbone Size:4761; Vector Backbone:Gateway® pDONR™221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-05 01:00:02 0
pET28-At_PRORP3-His
 
Resource Report
Resource Website 		RRID:Addgene_67871 PRORP3 Arabidopsis thaliana Kanamycin PMID:22976545 Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28-b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-05 01:00:01 0
pABD1275
 
Resource Report
Resource Website 		RRID:Addgene_68017 PHY-INTERACTING FACTOR 1 (PIF1) Arabidopsis thaliana Ampicillin PMID:29632208 Backbone Marker:Novagen; EMD Millipore; Backbone Size:3666; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon Optimized for bacterial expression (GenScript) 2026-09-05 01:00:02 0
pICSL11061
 
Resource Report
Resource Website 		RRID:Addgene_68255 Promoter_AtU6-26 + sgRNA_BolC.GA4a-1 Arabidopsis thaliana Ampicillin PMID:26616834 Target sequence: GTTTTCACTTGCGGCCGGAG Vector Backbone:pICH47751 (AddGene #48002); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-05 01:00:04 0
pU6-26 (GB1001)
 
Resource Report
Resource Website 		RRID:Addgene_68208 AtU6-26 promoter Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-09-05 01:00:04 0
pPML1 (GB0045)
 
Resource Report
Resource Website 		RRID:Addgene_68164 AtML1 promoter Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-09-05 01:00:03 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch