Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: MIR319a
Vector Backbone Description: Backbone Size:2964; Vector Backbone:pBluescriptSK+; Vector Types:Plant Expression, RNAi, Plant gene inactivation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16531494
Comments: See http://wmd3.weigelworld.org/
for more information
Proper citation: RRID:Addgene_22846 Copy
Species: Arabidopsis thaliana
Genetic Insert: At4CL
Vector Backbone Description: Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26860871
Proper citation: RRID:Addgene_73394 Copy
Species: Arabidopsis thaliana
Genetic Insert: At4CL
Vector Backbone Description: Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26860871
Proper citation: RRID:Addgene_73392 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB
Vector Backbone Description: Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26035630
Proper citation: RRID:Addgene_66571 Copy
Species: Arabidopsis thaliana
Genetic Insert: CUC3
Vector Backbone Description: Vector Backbone:pGBKT7; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64809 Copy
Species: Arabidopsis thaliana
Genetic Insert: TCP4
Vector Backbone Description: Vector Backbone:JW771 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23555288
Proper citation: RRID:Addgene_64813 Copy
Species: Arabidopsis thaliana
Genetic Insert: TCP4
Vector Backbone Description: Vector Backbone:pYES-DEST52; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64810 Copy
Species: Arabidopsis thaliana
Genetic Insert: TCP4
Vector Backbone Description: Vector Backbone:pDEST22; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23555288
Proper citation: RRID:Addgene_64812 Copy
Species: Arabidopsis thaliana
Genetic Insert: CUC2
Vector Backbone Description: Vector Backbone:JW772 (pCAMBIA2300); Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25448000
Proper citation: RRID:Addgene_64819 Copy
Species: Arabidopsis thaliana
Genetic Insert: Telomere
Vector Backbone Description: Backbone Size:9189; Vector Backbone:pTF101.1; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:17085598
Comments: Please note that Addgene NGS found a 1.5kb deletion in the telomere repeats as compared to the original depositor sequence. The depositor has confirmed that the telomere sequence in the plasmid is inherently unstable, and that the plasmid is still functional for telomere truncation.
The plasmid was also verified by restriction digest. The gel image is provided on this page under- Resource Information- Addgene Notes.
Proper citation: RRID:Addgene_65721 Copy
Species: Arabidopsis thaliana
Genetic Insert: GSGGGG spacer-Degron-TEV protease site-3x FLAG epitope
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, template to generate cassettes for -mediated knock-in; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26552885
Proper citation: RRID:Addgene_69490 Copy
Species: Arabidopsis thaliana
Genetic Insert: Cry2 PHR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24920824
Proper citation: RRID:Addgene_64212 Copy
Species: Arabidopsis thaliana
Genetic Insert: Cry2 PHR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24920824
Proper citation: RRID:Addgene_64213 Copy
Species: Arabidopsis thaliana
Genetic Insert: PIAL2
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:6700; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25415977
Proper citation: RRID:Addgene_67908 Copy
Species: Arabidopsis thaliana
Genetic Insert: CTG10
Vector Backbone Description: Backbone Marker:Invitrogen; life technologies Thermo Fisher Scientific; Backbone Size:4761; Vector Backbone:Gateway® pDONR™221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29632208
Proper citation: RRID:Addgene_67917 Copy
Species: Arabidopsis thaliana
Genetic Insert: PRORP3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28-b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22976545
Proper citation: RRID:Addgene_67871 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHY-INTERACTING FACTOR 1 (PIF1)
Vector Backbone Description: Backbone Marker:Novagen; EMD Millipore; Backbone Size:3666; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29632208
Proper citation: RRID:Addgene_68017 Copy
Species: Arabidopsis thaliana
Genetic Insert: Promoter_AtU6-26 + sgRNA_BolC.GA4a-1
Vector Backbone Description: Vector Backbone:pICH47751 (AddGene #48002); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target sequence: GTTTTCACTTGCGGCCGGAG
Proper citation: RRID:Addgene_68255 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtU6-26 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68208 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtML1 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68164 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
