Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
http://antibodyregistry.org/AB_2923418
Comments: "Antibody was produced by CEGAV (France) and recognises prepro-Gnrh1 (seabream prepro-GnRH1 form) from sea bass and other perciform species"
Host Organism: guinea pig
Clonality: polyclonal
Target(s): gonadotrophin-releasing hormone-associated peptide (Gap) 1, seabream Gap form
Proper citation: (Olivier Kah. CNRS-Université de Rennes 1 Cat# anti-sbGAP, RRID:AB_2923418) Copy
http://antibodyregistry.org/AB_2920670
Comments: Application: ICC/IF, IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Synaptopodin/SYNPO
Proper citation: (Progen Cat# GP94-N, RRID:AB_2920670) Copy
http://antibodyregistry.org/AB_2920693
Comments: Application: IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Keratin K75
Proper citation: (Progen Cat# GP-K6HF, RRID:AB_2920693) Copy
http://antibodyregistry.org/AB_2920673
Comments: Application: ICC/IF, IHC, WB
Host Organism: guinea pig
Clonality: unknown
Target(s): keratins
Proper citation: (Progen Cat# GP14, RRID:AB_2920673) Copy
http://antibodyregistry.org/AB_2920669
Comments: Application: IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): K14
Proper citation: (Progen Cat# GP-CK14, RRID:AB_2920669) Copy
http://antibodyregistry.org/AB_2920821
Host Organism: guinea pig
Clonality: unknown
Target(s): CYP17A1
Proper citation: (K. Nishimoto, Department of Uro-Oncology, Saitama Medical University International Medical Center Cat# Nishimoto_CYP17A1, RRID:AB_2920821) Copy
http://antibodyregistry.org/AB_2920679
Comments: Application: IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): keratin K5
Proper citation: (Progen Cat# GP-CK5, RRID:AB_2920679) Copy
http://antibodyregistry.org/AB_2921270
Comments: Tamamaki et a., 2000. Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection in vivo. Neurosci Res 38:231– 236: "For the production of anti-GFP antibodies, the full coding sequence of GFP was amplified by polymerase chain reaction (PCR) by using the pGG16 as a template. The sequences of the primers used for the PCR were ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGC. The blunt-ended PCR product was cloned into pGEX-4T2 (Amersham-Pharmacia Biotech, USA) at the SmaI site, and glutathioneS-transferase(GST)-GFP fusion protein was induced in E. coli by adding isopropyl-1-thio-beta-D-galactopyranoside (IPTG) to the medium. GFP was purified according to the protocol recommended by the manufacturer of the GST-system (Amersham-Pharmacia Biotech, USA). The purified GFP was emulsified with Freund’s complete adjuvant (Difco, USA; Johnstone and Thorpe, 1987), and injected intracutaneously into female rabbits (2 mg/animal) and guinea pigs (0.5 mg/animal). Four weeks after the immunization, the same amount of GFP emulsified with incomplete Freund’s adjuvant was injected into the animals. The sera were recovered 10–20 days after the second immunization. Antibodies were further affinity-purified with GFP-conjugated Affigel 10 gel (BioRad, USA); (2 mg GFP/1 ml gel). After 25 mg of crude g-globulin fraction was applied to 1 ml of the antigen column, the specific antibodies were eluted with 0.1 M glycine-HCl, pH2.5."
Host Organism: guinea pig
Clonality: polyclonal
Target(s): artificial protein
Proper citation: (Takeshi Kaneko - Kyoto University Cat# eGFP1, RRID:AB_2921270) Copy
http://antibodyregistry.org/AB_2877638
Host Organism: guinea pig
Clonality: polyclonal
Target(s): insulin
Proper citation: (Abcam Cat# ab195956, RRID:AB_2877638) Copy
http://antibodyregistry.org/AB_2943528
Comments: Applications: WB; IHC; FFPE (IHC-P); IHC-frozen no signal human CD11b
Host Organism: guinea pig
Clonality: recombinant monoclonal
Target(s): CD11b
Proper citation: (HistoSure by Synaptic Systems Cat# HS-384 308, RRID:AB_2943528) Copy
http://antibodyregistry.org/AB_2943410
Comments: Applications: WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): PSD95
Proper citation: (Oasis Biofarm Cat# OB-PGP053, RRID:AB_2943410) Copy
http://antibodyregistry.org/AB_2938943
Comments: Antigen retrieval is recommended before IHC/IF staining.
Host Organism: guinea pig
Clonality: polyclonal
Target(s): ACSBG1
Proper citation: (Oasis Biofarm Cat# OB-PGP010, RRID:AB_2938943) Copy
http://antibodyregistry.org/AB_2938951
Comments: Antigen retrieval is recommended before IHC/IF staining
Host Organism: guinea pig
Clonality: polyclonal
Target(s): S100B
Proper citation: (Oasis Biofarm Cat# OB-PGP015, RRID:AB_2938951) Copy
http://antibodyregistry.org/AB_2938945
Comments: Antigen retrieval is recommended before IHC/IF staining.
Host Organism: guinea pig
Clonality: polyclonal
Target(s): FABP7/BLBP
Proper citation: (Oasis Biofarm Cat# OB-PGP011, RRID:AB_2938945) Copy
http://antibodyregistry.org/AB_2938968
Comments: Antigen retrieval is recommended before IHC/IF staining.
Host Organism: guinea pig
Clonality: polyclonal
Target(s): NFIA
Proper citation: (Oasis Biofarm Cat# OB-PGP059, RRID:AB_2938968) Copy
http://antibodyregistry.org/AB_2938963
Comments: Antigen retrieval is required before IHC/IF-Fr staining
Host Organism: guinea pig
Clonality: polyclonal
Target(s): QKI5
Proper citation: (Oasis Biofarm Cat# OB-PGP026, RRID:AB_2938963) Copy
http://antibodyregistry.org/AB_2938906
Comments: Antigen retrieval is optional before IHC/IF-Fr staining
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Mapt/Tau
Proper citation: (Oasis Biofarm Cat# OB-PGP056, RRID:AB_2938906) Copy
http://antibodyregistry.org/AB_2938894
Comments: Antigen retrieval is recommended
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Parvalbumin
Proper citation: (Oasis Biofarm Cat# OB-PGP005, RRID:AB_2938894) Copy
http://antibodyregistry.org/AB_2938927
Comments: Antigen retrieval is required before IHC/IF staining
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Nestin
Proper citation: (Oasis Biofarm Cat# OB-PGP020, RRID:AB_2938927) Copy
http://antibodyregistry.org/AB_2938883
Comments: Antigen retrieval is optional before IHC/IF-Fr staining.
Host Organism: guinea pig
Clonality: polyclonal
Target(s): TH
Proper citation: (Oasis Biofarm Cat# OB-PGP064, RRID:AB_2938883) Copy
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
