Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 34 showing 661 ~ 680 out of 1,283,907 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to an Authentication Report or Collection

http://antibodyregistry.org/AB_2662682

Comments: Discontinued: 2025; Applications: ICC/IF (1-10 µg/mL)
Host Organism: mouse
Clonality: monoclonal
Target(s): P-cadherin

Proper citation: Thermo Fisher Scientific Cat# MA3-24000-A555, RRID:AB_2662682 Copy   


http://antibodyregistry.org/AB_2662753

Comments: Discontinued: 2023; Applications: Flow (5µL (0.5 µg)/test)
Host Organism: mouse
Clonality: monoclonal
Target(s): CD34

Proper citation: Thermo Fisher Scientific Cat# 64-0349-41, RRID:AB_2662753 Copy   


Discontinued

http://antibodyregistry.org/AB_2662655

Comments: Discontinued: 2020; Applications: Flow (5 µL (0.5 µg)/test)
Host Organism: mouse
Clonality: monoclonal
Target(s): CD11c

Proper citation: Thermo Fisher Scientific Cat# 67-0116-41, RRID:AB_2662655 Copy   


http://antibodyregistry.org/AB_2662722

Comments: Discontinued: 2023; Applications: Flow (5 µL (0.25 µg)/test)
Host Organism: mouse
Clonality: monoclonal
Target(s): CD27

Proper citation: Thermo Fisher Scientific Cat# 63-0279-41, RRID:AB_2662722 Copy   


http://antibodyregistry.org/AB_2662712

Comments: Discontinued: 2023; Applications: Flow (1 µg/test)
Host Organism: mouse
Clonality: monoclonal
Target(s): CD95 (APO-1/Fas)

Proper citation: Thermo Fisher Scientific Cat# 62-0951-80, RRID:AB_2662712 Copy   


Discontinued

http://antibodyregistry.org/AB_2662734

Comments: Discontinued: 2020; Applications: Flow (0.125 µg/test)
Host Organism: mouse
Clonality: monoclonal
Target(s): NK1.1

Proper citation: Thermo Fisher Scientific Cat# 62-5941-80, RRID:AB_2662734 Copy   


http://antibodyregistry.org/AB_2687478

Comments: ImmunoCytotoxicityochemistry, Intracellular staining (flow Cytotoxicityometry), Neutralization
Clonality: monoclonal
Target(s): CD69

Proper citation: BD Biosciences Cat# 562920, RRID:AB_2687478 Copy   


  • RRID:AB_2687678

http://antibodyregistry.org/AB_2687678

Comments: "A His-tagged fusion protein (pET 30 vector; Novagen, San Diego, CA) encoding 157 C-terminal amino acids of the cytoplasmic domain of cadherin-11 was purified using standard methods. Fusion protein, 100–300 μg, was combined with Freund's adjuvant and injected intraperitoneally into BALB/c mice. Hybridoma fusion protocol was performed using standard methods (Harlow and Lane, 1988 blue right-pointing triangle). Hybridomas were screened by ELISA, Western blot, immunofluorescence, and immunoprecipitation to test immunoreactivity to endogenous cadherin-11 and minimal cross-reactivity to N- and C-cadherin. The mAb 1B4 showed a very low affinity for overexpressed N-cadherin and no detectable affinity for C-cadherin." - PMID:18946084
Host Organism: mouse
Clonality: monoclonal
Target(s): Xenopus Cadherin-11 cytoplasmic domain

Proper citation: Dominique Alfandari - University of Massachusetts Amherst Cat# Alfandari-8, RRID:AB_2687678 Copy   


  • RRID:AB_2687586

    This resource has 10+ mentions.

http://antibodyregistry.org/AB_2687586

Comments: Image validation available for ICC/IF in MDS.
Host Organism: rat
Clonality: monoclonal
Target(s): Deadpan

Proper citation: Abcam Cat# ab195173, RRID:AB_2687586 Copy   


http://antibodyregistry.org/AB_2687546

Comments: Intracellular staining (flow Cytotoxicityometry)
Host Organism: mouse
Clonality: monoclonal
Target(s): Mouse RORγt

Proper citation: BD Biosciences Cat# 562682, RRID:AB_2687546 Copy   


  • RRID:AB_2687455

    This resource has 10+ mentions.

http://antibodyregistry.org/AB_2687455

Comments: Flow cytometry
Host Organism: rat
Clonality: monoclonal
Target(s): CD45

Proper citation: BD Biosciences Cat# 563709, RRID:AB_2687455 Copy   


  • RRID:AB_2687569

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687569

Comments: Intracellular staining (flow Cytotoxicityometry)
Host Organism: rat
Clonality: monoclonal
Target(s): IL-4

Proper citation: BD Biosciences Cat# 564004, RRID:AB_2687569 Copy   


  • RRID:AB_2687667

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687667

Comments: Image validation available for WB in MDS.
Host Organism: rabbit
Clonality: monoclonal
Target(s): C-terminus in Snap29

Proper citation: Abcam Cat# ab138500, RRID:AB_2687667 Copy   


  • RRID:AB_2687436

    This resource has 10+ mentions.

http://antibodyregistry.org/AB_2687436

Comments: Image validation for WB, IP in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): YTHDF3

Proper citation: Santa Cruz Biotechnology Cat# sc-377119, RRID:AB_2687436 Copy   


  • RRID:AB_2687564

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687564

Comments: Image validation available for WB, IF in MDS.
Host Organism: mouse
Clonality: monoclonal
Target(s): JAK1

Proper citation: Santa Cruz Biotechnology Cat# sc-376996, RRID:AB_2687564 Copy   


  • RRID:AB_2687476

    This resource has 10+ mentions.

http://antibodyregistry.org/AB_2687476

Comments: Applications: W, IP
Host Organism: rabbit
Clonality: monoclonal
Target(s): SGK1

Proper citation: Cell Signaling Technology Cat# 12103, RRID:AB_2687476 Copy   


  • RRID:AB_2687558

    This resource has 1+ mentions.

http://antibodyregistry.org/AB_2687558

Host Organism: mouse
Clonality: monoclonal
Target(s): GFP

Proper citation: Cusabio Biotech Cat# CSB-MA000051M0m, RRID:AB_2687558 Copy   


http://antibodyregistry.org/AB_2687590

Comments: Applications: Isotype control, Flow cytometry
Host Organism: mouse
Clonality: monoclonal
Target(s): myeloma protein

Proper citation: BD Biosciences Cat# 565571, RRID:AB_2687590 Copy   


Ratings or validation data are available for this resource

http://antibodyregistry.org/AB_2687580

Comments: Applications: W, IHC-P, IF-IC, F
Host Organism: rabbit
Clonality: monoclonal
Target(s): Cathepsin B

Proper citation: Cell Signaling Technology Cat# 31718, RRID:AB_2687580 Copy   


  • RRID:AB_2687430

http://antibodyregistry.org/AB_2687430

Comments: "Next, we attempted to isolate bnAbs from cow #26. Peripheral blood mononuclear cells (PBMCs) from timepoints d70 and d238 were sorted with fluorophores conjugated to anti-cow IgG, and biotinylated BG505 SOSIP was used as antigen bait as described previously (Extended Data Fig. 4) 21. Sorting and screening of PBMCs at different timepoints (Extended Data Fig. 5) using different sort strategies (Extended Data Fig. 4) resulted in the isolation of 10 mAbs named NC-Cow1 to NC-Cow10. Sequences and alignments of the heavy and light chain sequences for NC-Cow1 to NC-Cow10 are listed in Supplementary Table 2. Interestingly, all 10 antibodies have ultralong HCDR3s (Fig. 3a)"
Heavy Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCAAGGTGCAGCTGCAGGAGTCGGGCCCCAGCCTGGTGAAGCCGTCACAGACCCTCTCCCTCACCTGCACGGTCTCTGGATTCTCATTGAGCGACGTGGCTGTAGGCTGGGTCCGCCAGGCTCCAGGGAAGGCGCTGGAGTGGCTCGGTACGATATACACTAGTGGAAACACAAACGTTAACCCAGGCCTGAAATCCCGGCTCAGCATCACTAAGGACAACGCCAAGAGCCAAGTCTCTCTATCAGTGACCAGCTTGACAACTGACGACTCGGCCACATACTACTGTACTACTGTATACCAGAAAACAACGAAAAAAGATTGTCCGGAGTATTATACTTATAATCCCGATTGCGCGAGGCGCTATGGTTGGAGTGACTGTGAATGTATGGCAGATAAATTTGGGGGTTATTGTCGTCATGATGGTTGTGCTACTAATACAGTCCGTAGTACTTACGAATGGCACCTCGATGCCTGGGGCCAAGGACTCCTGGTCACCGTCTCCTCA
Light Chain Nucleotide: ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATCAGGCTGTGCTGACTCAACCATCATCCGTGTCCGGGTCCCTGGGCCGGAGGGTCTCCATCACCTGCTCTGGAAGCAGCAGCAATGTTGGAAATGGATATGTGAGTTGGTACCAAGTGATCCCAGGATCGGCCCCCAGAACCCTCATCTATGGTGACAGCAATCGAGCCTCGGGGGTCCCCGACCGATTCTCCGGGTCCAGGTCTGGGAACACAGCCACCCTGACCATCAGCTCGCTCCAGGCTGAGGACGAGGCAGATTATTTCTGTGGCTCTGCTGAGGATGGTAGCGGTAGTGGCGTTTTCGGCAGCGGGACCACACTGACCGTCCTG
Host Organism: cow
Clonality: monoclonal
Target(s): HCDR3

Proper citation: International AIDS Vaccine Initiative (IAVI) Cat# NC-Cow8, RRID:AB_2687430 Copy   



Can't find your Antibody?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X