Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00062835
Proper Citation: RRID:WB-STRAIN:WBStrain00062835
Description: Caenorhabditis elegans with name ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. from WB.
Species: Caenorhabditis elegans
Synonyms: ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I.
Notes: ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:
Affected Gene: WBGene00000912(daf-16)|WBGene00002101(ins-18)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I..
No alerts have been found for ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I..
Source: Integrated Animals
Source Database: WormBase (WB)