Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
VC1583
RRID:WB-STRAIN:WBStrain00036709 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00036709
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00036709

Proper Citation: RRID:WB-STRAIN:WBStrain00036709

Description: Caenorhabditis elegans with name cdh-1(gk747) III. from WB.

Species: Caenorhabditis elegans

Synonyms: cdh-1(gk747) III.

Notes: Mutagen:UV/TMP|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC."|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Affected Gene: WBGene00019994(cdh-1)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for VC1583.

No alerts have been found for VC1583.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)