Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00054976
Proper Citation: RRID:WB-STRAIN:WBStrain00054976
Description: Caenorhabditis elegans with name cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. from WB.
Species: Caenorhabditis elegans
Synonyms: cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V.
Notes: mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
Affected Gene: WBGene00000868(cyb-3)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V..
No alerts have been found for cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V..
Source: Integrated Animals
Source Database: WormBase (WB)