Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39128170
Proper Citation: RRID:RGD_39128170
Description: Rattus norvegicus with name SHRSP-Stim1em1Izm from RGD.
Species: Rattus norvegicus
Notes: "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence. The sequence of the guide RNA target site is as follows, Stim1: 5'-GCAGGGTAGCTGAAACACAC-3' The sequence of the ssODN for homologous recombination is as follows, 5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" National BioResource Project for the Rat in Japan
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SHRSP-Stim1em1Izm.
No alerts have been found for SHRSP-Stim1em1Izm.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
