Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142773
Proper Citation: RRID:RGD_629142773
Description: Rattus norvegicus with name SS-Rrg3em1Mcwi from RGD.
Species: Rattus norvegicus
Notes: Cas9 and sgRNA targeting the sequence GGGCATCTTCTGCCACCTAC were injected into SS embryos to mutate a CTCF binding site within the first intron of Ren. An 11-bp deletion rn6 chr13:50,509,649-50,509,659 resulted. Custom Rats at Medical College of Wisconsin, Email: [email protected]
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SS-Rrg3em1Mcwi.
No alerts have been found for SS-Rrg3em1Mcwi.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
