Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616390066
Proper Citation: RRID:RGD_616390066
Description: Rattus norvegicus with name SD-CdCSem1Bcgen+/- from RGD.
Species: Rattus norvegicus
Notes: To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-CdCSem1Bcgen+/-.
No alerts have been found for SD-CdCSem1Bcgen+/-.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
