Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
SD-CdCSem1Bcgen+/-
RRID:RGD_616390066 RRID Copied  
PDF Report How to cite
RRID:RGD_616390066
Copy Citation Copied
Organism Information

URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616390066

Proper Citation: RRID:RGD_616390066

Description: Rattus norvegicus with name SD-CdCSem1Bcgen+/- from RGD.

Species: Rattus norvegicus

Notes: To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product).

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for SD-CdCSem1Bcgen+/-.

No alerts have been found for SD-CdCSem1Bcgen+/-.

Data and Source Information

Source: Integrated Animals

Source Database: Rat Genome Database (RGD)