Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
SD-Esr1em1Bra-/-
RRID:RGD_405649860 RRID Copied  
PDF Report How to cite
RRID:RGD_405649860
Copy Citation Copied
Organism Information

URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405649860

Proper Citation: RRID:RGD_405649860

Description: Rattus norvegicus with name SD-Esr1em1Bra-/- from RGD.

Species: Rattus norvegicus

Notes: Two target sequences (GCCGTGTTCAACTACCCCGAGGG and GCTGCGCAAGTGTTACGAAGTGG) within the second and third exon, respectively, of the coding sequence of Esr1 (the rat gene encoding ERα) were selected. gRNAs targeting these sequences were synthesized via in vitro transcription. gRNAs (25 ng/ul each) were co- microinjected with Cas9 protein (40 ng/ul) into Sprague-Dawley rat embryos, and embryos were transferred into pseudo-pregnant recipients. Animals heterozygous for a 25 base pair deletion in Esr1 exon 3 were used to establish an ER alpha mutant colony and subsequent homozygous mutant offspring were obtained for study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for SD-Esr1em1Bra-/-.

No alerts have been found for SD-Esr1em1Bra-/-.

Data and Source Information

Source: Integrated Animals

Source Database: Rat Genome Database (RGD)