Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938653
Proper Citation: RRID:RGD_401938653
Description: Rattus norvegicus with name SD-Ctnsem1Odev from RGD.
Species: Rattus norvegicus
Notes: The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns. Contact Olivier Devuyst at Email: [email protected], National BioResource Project for the Rat in Japan
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Ctnsem1Odev.
No alerts have been found for SD-Ctnsem1Odev.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
