Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152985692
Proper Citation: RRID:RGD_152985692
Description: Rattus norvegicus with name WAG-Cd247em9Mcwi from RGD.
Species: Rattus norvegicus
Notes: CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. A single guide RNA (sgRNA) targeting the Cd247 exon 2 sequence GATGGAATCCTCTTCATCTACGG (protospacer adjacent motif in bold) was injected along with SpCas9 protein into one-cell WAG embryos. A founder offspring harboring a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) was identified and confirmed by Sanger sequencing. The frameshift mutation is predicted to cause a premature truncation of the normal 165 amino acid protein coding sequence after only 37 amino acids, lacking most of the transmembrane and the entirety of the external cellular protein domains. Contact MCW rat distribution at [email protected].
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for WAG-Cd247em9Mcwi.
No alerts have been found for WAG-Cd247em9Mcwi.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
