Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=124715482
Proper Citation: RRID:RGD_124715482
Description: Rattus norvegicus with name SS-Shc1em6Mcwi from RGD.
Species: Rattus norvegicus
Notes: Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This model harbors a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. Contact MCW rat distribution at [email protected]
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SS-Shc1em6Mcwi.
No alerts have been found for SS-Shc1em6Mcwi.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
