Resource Summary Report  New Search

URL: http://www.addgene.org/23022

Proper Citation: RRID:Addgene_23022

Insert Name: c-src

Organism: Mus musculus

Bacterial Resistance: Ampicillin

Defining Citation: PMID:9343417

Vector Backbone Description: Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Comments: This clone was assembled from multiple PCR products by using the following primers, described by their sequence relationship to the transcribed DUP RNA. DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33 exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo- gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2 and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6 (TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron 1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA GAA) also contains the ApaI site and is complementary to intron 1 and primer DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon 1. A series of PCRs was performed with the following primers and templates. Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4, 5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the 1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8 PCR products as templates. A final PCR assembled a complete fragment by using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final PCR product was cleaved with NsiI and DraIII and inserted into the CMV DUP33 vector also cleaved with NsiI and DraIII. This clone was designated DUP4-1.

Expand All Collapse