Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Authors: Caio Maximino, Monica Gomes Lima-Maximino, Diógenes Silva
Summary: Environmental and housing conditions experienced by laboratory animals exert profound effects on their biology, physiology, and behavior. These parameters are important and often overlooked sources of potential variation in experiments, and should be reported in peer-reviewed publications in order to promote scientific reproducibility. To that end, here we provide a summary of the environmental conditions in zebrafish (Danio rerio) at tanks at Laboratório de Neurociências e Comportamento 'Frederico Guilherme Graeff' (LaNeC), located in the Universidade Federal do Sul e Sudeste do Pará, Marabá/PA, Brazil. Included are data on the physico-chemical characteristics of the water, as well health, of zebrafish in separate tanks at LaNeC. This protocol was based on Lawrence's (https://dx.doi.org/10.17504/protocols.io.mrjc54n), and is forked from that.
Proper citation: Caio Maximino, Monica Gomes Lima-Maximino, Diógenes Silva 2019. Zebrafish (Danio rerio) Environmental Summary, LaNeC (Marabá/PA, Brazil). protocols.io https://dx.doi.org/10.17504/protocols.io.rupd6vn Copy
Authors: Addgene The Nonprofit Plasmid Repository
Summary: The following protocol is for making LB agar plates for the purpose of bacterial selection (500mL of LB agar makes about 25 LB agar plates). Please see the Addgene website for additional details.
Proper citation: Addgene The Nonprofit Plasmid Repository 2019. Pouring LB Agar Plates. protocols.io https://dx.doi.org/10.17504/protocols.io.5icg4aw Copy
Authors: Ji Gao
Summary: Simple measurement of XylE (Catechol 2,3-Dioxygenase) enzyme activity by microplate reader. Catechol 2,3-Dioxygenase can catalyze catechol (1,2-Dihydroxybenzene) to 2-HMS, which has a high absorbance at 377 nm, so we may use photometric mode of microplate reader to measure the concentration of 2-HMS, product of the enzyme.
Proper citation: Ji Gao 2019. Measurement of XylE (Catechol 2,3-Dioxygenase) enzyme activity by microplate reader. protocols.io https://dx.doi.org/10.17504/protocols.io.7suhnew Copy
Authors: Jonas Sawierucha, Marion Posset, Viola Hähnel, Christian L. Johnson, James A. Hutchinson, Norbert Ahrens
Proper citation: Jonas Sawierucha, Marion Posset, Viola Hähnel, Christian L. Johnson, James A. Hutchinson, Norbert Ahrens 2019. Comparison of two column agglutination tests for red blood cell antibody testing. protocols.io https://dx.doi.org/10.17504/protocols.io.vdxe27n Copy
Authors: Driss LAHLOU KITANE, Salma LOUKMAN, Nabila Marchoudi, Nawfel Azami
Proper citation: Driss LAHLOU KITANE, Salma LOUKMAN, Nabila Marchoudi, Nawfel Azami 2020. COVID 19 testing using ATR spectrometer and AI.. protocols.io https://dx.doi.org/10.17504/protocols.io.bqw2mxge Copy
Authors: Eliana Rocio Rodríguez Gómez, William Otero Regino, Pedro A. Monterrey, Alba Alicia Trespalacios Rangel
Summary: In this study , we aimed to determine the current circulation of cagA gene EPIYA motifs present in Colombian Helicobacter pylori isolates using a rapid molecular test. The cagA gene 3' region was amplified through conventional Polymerase Chain Reaction (PCR) and PCR products obtained were sequenced and analyzed with bioinformatics tools.Aditionally, to confirm the prediction of the number EPIYA C repeats based on the PCR product molecular weight, reamplification and secuencing analysis were performed.
Proper citation: Eliana Rocio Rodríguez Gómez, William Otero Regino, Pedro A. Monterrey, Alba Alicia Trespalacios Rangel 2019. Molecular biology test for rapid detection cagAgen EPIYA motif in H.pylori isolates. protocols.io https://dx.doi.org/10.17504/protocols.io.54jg8un Copy
Authors: BinnypreetKaur1, 2, DrahomíraFaktorová1, 2, PriscilaPeñaDiaz1andJuliusLukeš1, 2
Group: Julius Lukes
Proper citation: BinnypreetKaur1, 2, DrahomíraFaktorová1, 2, PriscilaPeñaDiaz1andJuliusLukeš1, 2 2018. Alamar Blue Assay: Drug Sensitivity Test. protocols.io https://dx.doi.org/10.17504/protocols.io.hhfb33n Copy
Authors: Rachel Howard-Till, Claudia Osorio, Bradley Till
Summary: This protocol describes low-cost methods for the collection and desiccation of plant tissues and subsequent extraction of genomic DNA. It contains modifications of previously described methods found at https://link.springer.com/book/10.1007/978-3-319-16259-1 and https://link.springer.com/chapter/10.1007/978-3-319-45021-6_14. We have tested this protocol with leaf tissue from flax, Lupinus luteus, Camelina sativa and Berberis darwinii. DNA is suitable for routine molecular biology assays such as PCR and also for next generation sequencing.
Proper citation: Rachel Howard-Till, Claudia Osorio, Bradley Till 2020. Low-cost tissue collection and genomic DNA extraction for plants. protocols.io https://dx.doi.org/10.17504/protocols.io.bdg9i3z6 Copy
Authors: E. Dale Abel
Group: Diabetic Complications Consortium
Summary: This protocol describes the procedures used by the DiaComp for evaluating mitochondrial function.Diabetic Complication:References 1. Veksler VI, Kuznetsov AV, Sharov VG, Kapelko VI, Saks VA. Mitochondrial respiratory parameters in cardiac tissue: a novel method of assessment by using saponin-skinned fibers. Biochim Biophys Acta. 1987;892:191-6. 2. Saks VA, Veksler VI, Kuznetsov AV, Kay L, Sikk P, Tiivel T, Tranqui L, Olivares J, Winkler K, Wiedemann F, Kunz WS. Permeabilized cell and skinned fiber techniques in studies of mitochondrial function in vivo. Mol Cell Biochem. 1998;184:81-100. 3. Ouhabi R, Boue-Grabot M, Mazat JP. Mitochondrial ATP synthesis in permeabilized cells: assessment of the ATP/O values in situ. Anal Biochem. 1998;263:169-75.
Proper citation: E. Dale Abel 2019. Evaluation of Mitochondrial Function. protocols.io https://dx.doi.org/10.17504/protocols.io.7s8hnhw Copy
Authors: Junfei Xia, Hongrong Yang, Michelle Mu, Nicholas Micovic, Kira E. Poskanzer, James Monaghan, Heather Clark
Summary: This protocol provides a detailed decription of the experimental procedure, including nanosensor farbication and characterization, in vivo microinjection, and in vivo imaging of acetylcholine release in the submandibular ganglion of mice.
Proper citation: Junfei Xia, Hongrong Yang, Michelle Mu, Nicholas Micovic, Kira E. Poskanzer, James Monaghan, Heather Clark 2021. In vivo imaging of acetylcholine release in the peripheral nervous system with a fluorescent nanosensor. protocols.io https://dx.doi.org/10.17504/protocols.io.bmmxk47n Copy
Authors: Randy True
Group: FloodLAMP, XPRIZE Rapid Covid Testing
Summary: The inactivation protocol uses a chemical plus heat to break open cells (including virus, if present) and preserve the RNA. The inactivation can be done outside a lab setting, at the point of sample collection or drop-off. This is our preferred mode, and we refer to these as "inactivation stations". Prior to inactivation, the samples may contain live, contagious virus, so it is crucial that personnel use proper PPE and safe handling procedures. Many current community screening efforts are performing non-lab based sample processing (for example, Dave O'Connor and Chris Mason), and we have followed their examples with the use of splash guards in addition to PPE.After inactivation, samples should be refrigerated or stored on ice before same-day processing through the assay.On our website are our protocols in worksheet form as we use in the lab. This and more information will be live soon.
Proper citation: Randy True 2020. FloodLAMP Inactivation Protocol v3.1. protocols.io https://dx.doi.org/10.17504/protocols.io.bk5nky5e Copy
Authors: Francois Yves Bouget, Francois-Yves Bouget
Group: Protist Research to Optimize Tools in Genetics (PROT-G)
Summary: This protocol describes the preparation of cells and introduction of DNA into the cells by electroporation. For selection of stable transformants or measure of transient gene expression see related protocols.
Proper citation: Francois Yves Bouget, Francois-Yves Bouget 2019. Transient transformation of Ostreococcus species (OTTH595, RCC809 and RCC802) and Bathycoccus. protocols.io https://dx.doi.org/10.17504/protocols.io.83uhynw Copy
Authors: Janice E. Lawrence and Grieg F. Steward
Group: VERVE Net
Summary: Lawrence, J. E., and G. F. Steward. 2010. Purification of viruses by centrifugation, p. 166–181. In S. W. Wilhelm, M. G. Weinbauer, and C. A. Suttle [eds.], Manual of Aquatic Viral Ecology. ASLO.Please see the published manuscript for additional information.
Proper citation: Janice E. Lawrence and Grieg F. Steward 2015. Purification of viruses by centrifugation. protocols.io https://dx.doi.org/10.17504/protocols.io.d2v8e5 Copy
Authors: Kelsey Miller
Group: BioLegend
Summary: Target cells are depleted by incubating your sample with the biotin antibody cocktail followed by incubation with magnetic Streptavidin Nanobeads (Cat. No. 480015/480016). The magnetically labeled fraction is retained by the use of a magnetic separator. The untouched cells are collected. These are your cells of interest; do not discard the liquid. Some of the downstream applications include functional assays, gene expression, phenotypic characterization, etc.
Proper citation: Kelsey Miller 2016. MojoSort™ Isolation Kits No Wash Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.e2wbgfe Copy
Authors: David Eccles
Summary: This protocol is for comparing different samples at the transcript level, using long reads that are mapped to transcripts.Input(s): demultiplexed and oriented fastq files (see protocol Preparing Reads for Stranded Mapping), transcript reference fasta file, annotation fileOutput(s): transcript table, sorted by differential coverage, annotated with gene name / description / location
Proper citation: David Eccles 2020. Stranded Transcript Count Table Generation from Long Reads. protocols.io https://dx.doi.org/10.17504/protocols.io.bndema3e Copy
Authors: Christa Testerink, Anne Froyd-Rankenberg
Summary: Standard protocol to examine lipid binding of the proteins isolated from the E.coli with the GST tag
Proper citation: Christa Testerink, Anne Froyd-Rankenberg 2019. Liposome binding assay. protocols.io https://dx.doi.org/10.17504/protocols.io.pefdjbn Copy
Authors: Fatma Gomaa, Zhou Zhuha, Roberto Docampo, Virginia Edgcomb, Peter Girguis
Group: Protist Research to Optimize Tools in Genetics (PROT-G)
Proper citation: Fatma Gomaa, Zhou Zhuha, Roberto Docampo, Virginia Edgcomb, Peter Girguis 2018. Bodo saltans Cassette for tagging EF1alpha gene__IG BsTub. protocols.io https://dx.doi.org/10.17504/protocols.io.s5jeg4n Copy
Authors: New England Biolabs
Group: New England Biolabs (NEB)
Summary: This product can be used for the following applications:Cloning of restriction fragmentsJoining linkers and adapters to blunt-ended DNA
Proper citation: New England Biolabs 2021. Ligation Protocol with T4 DNA Ligase (M0202). protocols.io https://dx.doi.org/10.17504/protocols.io.bcchist6 Copy
Authors: Fatma Gomaa, ZhuHong Li, Roberto Docampo, Peter Girguis, Virginia Edgcomb
Summary: Before starting prepare the following:Measure the Luciferase plasmid concentration using NanoDrop and Qubit.Design the PCR primers for the gene of interest with the RE (restriction enzyme) sequence at the 5’.Add 3 to 4 nucleotides at the end of the RE sequence (These bps will be removed during the fragment digestion)Order TOPO 10 chemically competent coli cells and the other kits for digestion, ligation, gel purification.Protocol:Day 1:PCR amplification: (Use 10 -100 ng/ul of DNA of saltans) and the following forward and reverse primers with RE sequence to amplify gene or region of interest. Here we are using two forward primers, and one reverse primer to 0.6 and 3 kb respectively. One of these regions include the putative ribosomal promoter Gel electrophoresis:Check the PCR product using gel electrophoresis to make sure that you amplified the right fragment. PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step: You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerProtocol:Day 1:PCR amplification: (Use 10 -100 ng/ul of DNA of saltans) and the following forward and reverse primers with RE sequence to amplify gene or region of interest. Here we are using two forward primers, and one reverse primer to 0.6 and 3 kb respectively. One of these regions include the putative ribosomal promoter Gel electrophoresis:Check the PCR product using gel electrophoresis to make sure that you amplified the right fragment. PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step: You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primer A1Forward 8683-8713
CTGAAGCTTTGAAGGAAAGTCGAAACGCCGTGTGTGTG
Forward 6305-6332
CTGAAGCTTCGGTGTGTCGAGTGGAAGAAAGGACGAT
Reverse 9603-9634
ATCAAGCTTAGATTCCTGCAATGCAGTGATTCTGAGG
The PCR master mix (Master Mix 2 x NEB (Taq 2x))
PCR amplification profile is
1) 95 C -30 SEC
2) 95 C -30 SEC
3) 61 C – 30 SEC
4) 68C- 60 SEC
GO TO 2 FOR 29 CYLCE
5) 68 C-5 MIN
6) HOLD 10 C
Make sure that you have more than 75 ul per reaction (3x25ul), we need a lot of PCR product for the fragment
of interest
Gel electrophoresis:Check the PCR product using gel electrophoresis to make sure that you amplified the right fragment. PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step: You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerCheck the PCR product using gel electrophoresis to make sure that you amplified the right fragment.PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step: You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerThis is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product.Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step: You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerThis step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step: You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine).Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerRemove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930) to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerMake sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it. It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerMake sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells [Be sure to keep the cells cold on ice! I usually don't take the tube of cells out of the -80 C freezer until 5 or 10 minutes before I'm going to use them] (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replicationDay 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerQubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.
Proper citation: Fatma Gomaa, ZhuHong Li, Roberto Docampo, Peter Girguis, Virginia Edgcomb 2018. Identifying an active promoter in B. saltans using Luciferase assay. protocols.io https://dx.doi.org/10.17504/protocols.io.sh5eb86 Copy
Authors: Stanton Burnton
Summary: This protocol is a parody of an existing scientific journal article and is intended to showcase the features available on the protocols.io platform in order for VERVE Net members to develope future protocols. While the viral metagenomic analysis on Cabbage Patch Kids is impossible to perform, due to the real-world non-existant nature of Cabbage Patch kids, the sourced article is Metagenomic analysis of viruses associated with field-grown and retail lettuce identifies human and animal viruses and the "Material and methods" section has been adapted from using actual lettuce data to a metagenomic protocol for Cabbage Patch Kids.
Proper citation: Stanton Burnton 2016. Viral metagenomic analysis on Cabbage Patch Kids. protocols.io https://dx.doi.org/10.17504/protocols.io.esabeae Copy
Can't find your Protocol?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific protocol and you know the DOI of the protocol already, it's easier to enter a DOI to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your protocol in the search results, please help us by adding it into the system — it's easy. Create and publish your protocols at Protocols.io.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.