SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Search

Type in a keyword to search

On page 87 showing 1721 ~ 1740 out of 8,330 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

Authors: Juan Pablo Pizarro, Raquel De la Fuente Anuncibay, Ángela González Barbadillo, González-Bernal, Esther Cubo
Summary: Mediating effect of mindfulness cognition on the development of empathy in a university context We are conducting a study related to Mindfulness and Empathy in the university population in order toexplore the psychological variables underlying both.The study consists of a series of sociodemographic questions and two tests, the duration of which isestimated at 10-20 minutes.The instruments used were Five Facet Mindfulness Questionnaire (Baer, Smith, Hopkins, Krietemeyer, & Toney, 2006) and Toronto Empathy Questionnaire (Spreng, McKinnon, Mar, & Levine, 2009).Participation is completely voluntary. The Research Team undertakes to maintain the anonymity of allparticipants, as well as to treat the information following the ethical rules of research for this type of study,so we ask you to answer with the utmost sincerity.

Proper citation: Juan Pablo Pizarro, Raquel De la Fuente Anuncibay, Ángela González Barbadillo, González-Bernal, Esther Cubo 2019. Mindfulness and Empathy University of Burgos. protocols.io dx.doi.org/10.17504/protocols.io.w8qfhvw Copy   


  • DOI: 10.17504/protocols.io.8nyhvfw

Authors: Claudia Troncone Clemente
Group: AEGIS - Madrid iGEM 2019
Summary: Our aim with this protocol is to amplify DNA. This protocol has been optimized has a general amplificationAs the quantity of DNA is exponentially increased during the performance of the selection, further modification in the numbers of cycle will be needed to be implemented.

Proper citation: Claudia Troncone Clemente 2019. PCR. protocols.io dx.doi.org/10.17504/protocols.io.8nyhvfw Copy   


Authors: Fatma Gomaa, ZhuHong Li, Roberto Docampo, Peter Girguis, Virginia Edgcomb
Summary: Before starting prepare the following:Measure the Luciferase plasmid concentration using NanoDrop and Qubit.Design the PCR primers for the gene of interest with the RE (restriction enzyme) sequence at the 5’.Add 3 to 4 nucleotides at the end of the RE sequence (These bps will be removed during the fragment digestion)Order TOPO 10 chemically competent coli cells and the other kits for digestion, ligation, gel purification.Protocol:Day 1:PCR amplification: (Use 10 -100 ng/ul of DNA of saltans) and the following forward and reverse primers with RE sequence to amplify gene or region of interest. Here we are using two forward primers, and one reverse primer to 0.6 and 3 kb respectively. One of these regions include the putative ribosomal promoter Gel electrophoresis:Check the PCR product using gel electrophoresis to make sure that you amplified the right fragment. PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step:  You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerProtocol:Day 1:PCR amplification: (Use 10 -100 ng/ul of DNA of saltans) and the following forward and reverse primers with RE sequence to amplify gene or region of interest. Here we are using two forward primers, and one reverse primer to 0.6 and 3 kb respectively. One of these regions include the putative ribosomal promoter Gel electrophoresis:Check the PCR product using gel electrophoresis to make sure that you amplified the right fragment. PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step:  You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primer A1Forward 8683-8713 CTGAAGCTTTGAAGGAAAGTCGAAACGCCGTGTGTGTG Forward 6305-6332 CTGAAGCTTCGGTGTGTCGAGTGGAAGAAAGGACGAT Reverse 9603-9634 ATCAAGCTTAGATTCCTGCAATGCAGTGATTCTGAGG   The PCR master mix (Master Mix 2 x NEB (Taq 2x))   PCR amplification profile is       1)     95 C -30 SEC 2)     95 C -30 SEC 3)     61 C – 30 SEC 4)     68C- 60 SEC GO TO 2 FOR 29 CYLCE 5)     68 C-5 MIN 6)     HOLD 10 C   Make sure that you have more than 75 ul per reaction (3x25ul), we need a lot of PCR product for the fragment of interest Gel electrophoresis:Check the PCR product using gel electrophoresis to make sure that you amplified the right fragment. PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step:  You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerCheck the PCR product using gel electrophoresis to make sure that you amplified the right fragment.PCR purification:This is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product. Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step:  You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerThis is a crucial step; you have to purify the PCR product using the column purification or beads method. Also make sure that you elute in a little volume around 15ul for total 75 ul of the purified PCR product.Restriction enzyme digest:This step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step:  You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine). Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerThis step should be done for both the plasmid and the PCR product in parallelMake sure that the digestion for both the PCR product and the plasmid does not exceed 3 hours, use the rapid digestion protocol.Saw the plasmid on iceTake only 750 ng of the luciferase plasmid (note: too much plasmid may not digest)X ul of vector or plasmid with insert1.7 ul of 10 Reaction Buffer1.5 ul of 10 Units/ul restriction enzyme (Hind III)Y ul of water such that the final volume is about= 17 ulDigest at least 3 or 4 hours. After digestion treat it with Calf Alkaline Phosphotase , CAP, for an hour at 37 C to prevent the vector from ligating back on itself.Use add 1/10 volume of CAP 10X Buffer + 1 ul of the enzyme, then heat inactivate this at 65 C for 10 minutes.Don’t recommend this step:  You can store this in a -20 C freezer before running it on the gel if you don't have time to run the gel that day.Add gel loading buffer containing bromophenol blue and glycerol and run out digested material on a 1% agarose gel.Make sure that you run the plasmid without digestion (control) as well to compare the sizes of the fragments.If you did not want to run the PCR product on gel that should be fine as long as it will be purified after RE digestion (I recommend to NOT run it, just go a head and purify it again with column or beads)Cut out the bands of interest (the vector and insert) with a separate sterile scalpel blade.Place the gel fragments in a 1.5 ml centrifuge tube and freeze at -20 for at least 10 minutes (longer is fine).Clean up of gel fragment using Sigma Genelute kit: ( I will send this kit to you)Remove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerRemove tubes containing gel fragments from -20 C freezer and place in 56 C heat block for 5 or 10 minutes to melt.Break up the gel fragment into pieces as small as possible with either a small pipette tip or small sterile spatula.Add 100 ul of TE Buffer to the columns and centrifuge at maximum micro-centrifuge speed for 10 seconds.Transfer column to a new collection tube (discard old tube with TE buffer in it) and transfer broken up gel fragment to the column, being sure the fragments are at the bottom of the column.Centrifuge at maximum micro-centrifuge speed for 10 minutes.Measure volume of recovered gel fragment and add 1/10 volume of sterile 3 M Sodium Acetate solution (for salt precipitation).Then add 2 volumes of 100% Ethanol and 1 micro-liter of 20 mg/ml glycogen solution (Qiagen #158930)  to help precipitate the DNA.Place this in a -20 C freezer for overnight.Day 2:Centrifuge the ethanol precipitation for 10-20 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet (pellet will be a small lightly colored "clear" pellet). Add 200 ul of 70% Ethanol to the tube carefully avoiding disturbing theDNA pellet and centrifuge for 3 minutes at maximum micro-centrifuge speed and pour or pipette off the ethanol without losing the DNA pellet. Briefly centrifuge again for 10 seconds and remove as much of the ethanol as possible with a pipette avoiding the DNA pellet then allow the pellet to air dry for about 10 or 15 minutes.Add a small volume of TE buffer (15 ul) carefully to the pellet  and place at room temperature for 30 minutes to suspend it. After 30 minutes pipette up and down a few times to ensure pellet is suspended then run 1 ul of the vector and 1 ul of insert out on a gel for visualization and qubit for quantitation.Ligation reaction:Make sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerMake sure that the ligation does not exceed 2 hours, use the rapid ligation protocolYou need about a 1: 5 ratio of vector to insert (so more insert than vector) you can use the following calculator to calculate insert to vector ratio. (http://www.promega.com/a/apps/biomath/index.html?calc=ratio)To a 1.5 ml tube in order, add:X ul restriction enzyme digested CAP treated vectorY ul insert2 ul 5X T4 Ligase bufferZ ul of water to bring final volume to 10 ul0.4 ul of T4 HC ligase enzyme (Invitrogen #15224-041... this has both the ligase enzyme and ligase buffer in it)Incubate tube at room temperature for 1-3 hour without disturbing it.  It is recommended to run PCR of the ligation mix to make sure that your insert has been integrated into the plasmid. Use the forward primer of the plasmid and the reverse primer of your insert.Bacterial Transformation:Make sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replication Day 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerMake sure that you transform positive and negative control as well along with your plasmids.Take 1 ul of ligation and dilute to 5 ul and then take 2.5 ul of this mix and transform the bacteria.Also you can use only 1 ul of the concentrated ligation and transform. I prefer the first option; it yielded more bacterial colonies.thawed-on-ice TOP-10 cells  [Be sure to keep the cells cold on ice!  I usually don't take the tube of cells out of the   -80 C freezer until 5 or 10 minutes before I'm going to use them]  (One Shot TOP10 Chemically Competent E. coli) and hold for 10 minutes on ice. Place rest of ligase reaction in -20 C freezer in case you need to repeat this.Heat shock tube of TOP-10 cells for 35 seconds in a precise 42 C water bath. Place tubes back on ice for 2 minutes and then add 210 ul of SOCmedia (this is included in the TOP-10 cells kit) to the tubes and incubate with shaking for 1 hour at 37 C. Spread out on a Miller's LB + Ampicillin (50 or 100 ug/ml) plate using a sterile plate spreaderDivide the cells for three plates, use all of the cells, and grow up overnight at 37 C.Don't let it go for more than 16 hours or you will get small background bacterial colonies growing up too.Save some of the bacteria in glycerol stock for future replicationDay 3ScreeningTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerTo screen for the right colonies prepare the following firstDepend on the number of the PCR reactions that you plan to run that day prepare equal number of eppendorf tubes that include 100 ul of LB broth  with the ampicillinPick up the white colony for the LB plate using the tooth pick, and insert the tooth pick in the PCR master mix and swirl a little bit, then put the same tooth pick in the LB broth in the 1.5 eppendorfDo that for each white colony you will amplify. To end up saving all the tooth picks in eppendofr that includes the LB broth.Amplify the white bacterial colonies using plasmid’s forward primer and your gene of interest reverse primer, this is to make sure that you have the right insertion size at the right orientation .Gel electrophoresis image will confirm whether the insert with the expected size was introduced to the plasmid or not.Go back to your eppendorf tubes and mark all the tubes that gave a positive PCR amplification at the expected size.Transfer the LB from this tubes to flasks or glass tubes that include 100 ml of LB broth + ampcilin and grow these into culture over night, I usually  make 4 different culture, each with 100 ml of LB broth.Day 4Next day at the morning start by saving some of the LB+ bacteria into glycerol stock (10-15 tubes), store them in -70C. For the rest of the culture start the plasmid prep following the protocol of Zymo Midi prep kit.Quantification:Qubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.PCR confirmation and sequencing: Using the plasmid forward primer and the insert reverse primerQubit all the eluted plasmids to document the plasmid concentration, I elute in 200 ul and usually I get between 200 to 300 ng/ul.

Proper citation: Fatma Gomaa, ZhuHong Li, Roberto Docampo, Peter Girguis, Virginia Edgcomb 2018. Identifying an active promoter in B. saltans using Luciferase assay. protocols.io dx.doi.org/10.17504/protocols.io.sh5eb86 Copy   


Authors: Linda A. Amaral-Zettler, Markus Bauer, Donna Berg-Lyons, Jason Betley, J. Greg Caporaso, Hugh W. Ducklow, Noah Fierer, Louise Fraser, Jack A. Gilbert, Niall Gormley, James Huntley, Susan M. Huse, Janet K. Jansson, Simon N. Jarman, Rob Knight, Chris L. Lauber, Elizabeth A. McCliment, Sarah M. Owens, Geoff Smith, Luke Thompson, Hege Vestheim, William A. Walters
Group: Earth Microbiome Project
Summary: The 18S protocol detailed here is designed to amplify eukaryotes broadly with a focus on microbial eukaryotic lineages. The primers target the 18S SSU rRNA and are based on those of Amaral-Zettler et al. (2009). The constructs are designed to be used with the Illumina platform.For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.The outlines of the protocol are the same as the 16S protocol, but different primers, PCR conditions, and sequencing primers are used. In addition, we have designed a blocking primer that reduces the amplification of vertebrate host DNA to be used on host-associated samples, especially those that have a low eukaryotic biomass. Blocking primer strategy is based on Vestheim et al. (2008).

Proper citation: Linda A. Amaral-Zettler, Markus Bauer, Donna Berg-Lyons, Jason Betley, J. Greg Caporaso, Hugh W. Ducklow, Noah Fierer, Louise Fraser, Jack A. Gilbert, Niall Gormley, James Huntley, Susan M. Huse, Janet K. Jansson, Simon N. Jarman, Rob Knight, Chris L. Lauber, Elizabeth A. McCliment, Sarah M. Owens, Geoff Smith, Luke Thompson, Hege Vestheim, William A. Walters 2018. EMP 18S Illumina Amplicon Protocol. protocols.io dx.doi.org/10.17504/protocols.io.nuvdew6 Copy   


Authors: Kaur G, Helmer RA, Smith LA, Martinez-Zaguilan R, Dufour JM, Chilton BS
Summary: Helicase-like transcription factor is regulated by alternative mRNA splicing. Global deletion of Hltf causes perinatal lethality, i.e. 75% die of hypoglycemia Hif-1α that regulates transport systems. Thus, we tested the hypothesis that Hltf deletion in placenta either caused or exacerbated neonatal hypoglycemia via Hif-1α regulation of nutrient transporters.  RNA-seq data analyses of the placentome identified significant changes in transcript expression and splicing. The iPathwayGuide tool was used for gene ontology (GO) analysis of biological processes, molecular functions and cellular components. The Elim pruning algorithm identified hierarchical relationships. The methylome was evaluated by Methyl-MiniSeq Epiquest analysis. GO analysis with DAVID identified gene enrichment within biological processes. Protein expression was visualized with immunohistochemistry. Although two Hltf mRNA isoforms are quantifiable in most murine tissues, only the truncated Hltf isoform is expressed in placenta. iPathwayGuide analysis identified targets − 157 genes of 11,538 total genes with measured expression – of the encoded Hltf protein. Hltf deletion altered transcription of trophoblast lineage-specific genes, and increased transcription of the Cxcr7 (p=0.004) gene whose protein product is a co-receptor for human and simian immunodeficiency viruses. Concomitant increased Cxcr7 protein was identified with immune labeling. Hltf gene deletion had no effect on transcription or site-specific methylation patters of Hif-1α, the major glucose transporters, or System A amino acid transporters. There was no measureable evidence of uteroplacental dysfunction or fetal compromise. iPathGuide analysis revealed Hltf suppresses cytolysis (10/21 genes; p-value 1.900e-12; p-value correction: Elim pruning; GO:019835) including the perforin-granzyme pathway in uterine natural killer cells. Our findings 1) identify a functional link between alternative splicing of Hltf and immunosuppression at the feto-maternal interface, and 2) underscore the importance of differential splicing analysis to identify functional diversity in the transcription factor under investigation.

Proper citation: Kaur G, Helmer RA, Smith LA, Martinez-Zaguilan R, Dufour JM, Chilton BS 2018. Protocol to accompany paper entitled "Alternative splicing of helicase-like transcription factor (Hltf): Intron retention-dependent activation of immune tolerance at the feto-maternal interface". protocols.io dx.doi.org/10.17504/protocols.io.pnidmce Copy   


Authors: Shuntai Zhou
Summary: This is the protocol to prepare Primer ID MiSeq sequencing library. Viral RNA was first extracted using QIAamp viral RNA extraction kit.  The block of random nucleotides (Ns) in the cDNA primers served as the Primer ID. The Superscript III kit was used for the cDNA synthesis. We used two rounds of PCR to amplify the cDNA and incorporate Illumina indexed adapters with KAPA2G Robust and KAPA HiFi PCR kits, respectively. 

Proper citation: Shuntai Zhou 2018. Primer ID MiSeq Library Prep. protocols.io dx.doi.org/10.17504/protocols.io.sjdeci6 Copy   


Authors: Elisangela Bressan, Ashutosh Dhingra, Stella Donato, Peter Heutink
Summary: The derivation of human induced pluripotent stem cells (iPSCs) into midbrain dopaminergic (mDA) neurons presents an exciting opportunity to access a large number of patients-specific cells in vitro, to model disease, perform target screenings, and test drug candidates. Previously published small molecule-based protocols are straightforward, implementable in automated cell culture systems (Dhingra et al. J Vis Exp. 162, 2020), and suitable for the differentiation of large sets of cell lines (Bressan et al. Protocols.io, 2020) at relatively low cost and working time. However, the derivation of mDA from a large set of human iPSC lines shows variations in differentiation efficiency between lines. In addition, the current protocols produce heterogeneous cell populations in which only a small subset represents the cells of interest. To address these issues, we optimized a previously established mDA neuron differentiation protocol (Kriks et al., Nature 480, 547–551, 2011) by: (1) adjusting the SMAD inhibition to improve and achieve more homogeneous neuron conversion between iPSC lines; (2) reinforcing the WTN signaling activation to trigger more efficient midbrain floor plate induction and conversion into mDA neurons, and (3) applying the DNA cross-linker Mitomycin-C to eliminate remaining proliferating cells. The optimized mDA neuron derivation protocol presented here resulted in more homogeneous differentiation between iPSC lines, higher yields of neurons with higher proportion of mDA neurons, and completely elimination of contaminating proliferative cells. .justify:after { content: ""; display:inline-block; width: 100%; }

Proper citation: Elisangela Bressan, Ashutosh Dhingra, Stella Donato, Peter Heutink 2021. Optimized Derivation of Midbrain Dopaminergic Neurons from iPSCs for research application. protocols.io dx.doi.org/10.17504/protocols.io.bsq5ndy6 Copy   


  • DOI: 10.17504/protocols.io.mctc2wn

Authors: Not known
Group: Zymoseptoria community protocols (STBnet)
Summary: Preparation  of Yeast-Sucrose-Broth, that is used as liquid media for growing Zt. This is called 'YSB' in Bruce McDonald lab. Have a look for example: Zain, M. E., et al. 'Influence of growth medium on diagnostic characters of Aspergillus and Penicillium species.' African Journal of Microbiology Research 3.5 (2009): 280-286.

Proper citation: Not known 2017. Yeast-Sucrose-Broth. protocols.io dx.doi.org/10.17504/protocols.io.mctc2wn Copy   


  • DOI: 10.17504/protocols.io.fmhbk36

Authors: Remco Stam
Group: Stam Lab
Summary: Growth Medium used for Alternaria Solani cultivationFirst described: Nirenberg 1981

Proper citation: Remco Stam 2016. SNA medium. protocols.io dx.doi.org/10.17504/protocols.io.fmhbk36 Copy   


  • DOI: 10.17504/protocols.io.jhhcj36

Authors: Bonnie Hurwitz, Ken Youens-Clark
Group: Hurwitz Lab, Metafunc Course 2017
Summary: This collection of protocols will help you to get started with computational resources needed for the class. We will also get accounts for each of these resources.

Proper citation: Bonnie Hurwitz, Ken Youens-Clark 2017. Week 1: Getting Started. protocols.io dx.doi.org/10.17504/protocols.io.jhhcj36 Copy   


Authors: Integrated Islet Distribution Program
Group: Integrated Islet Distribution Program
Summary: To establish a standardized method for the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) sponsored research in the Integrated Islet Distribution Program (IIDP) for preparing a sentinel flask of human islets in order to monitor sterility and islet integrity at the production center. This is a representative sample of the islet preparation that has been distributed to investigators and is held at the distributing center as a quality control sample. The islets are cultured in the same shipping media used for islet shipment, for 18 hours at 4-8°C, simulating the cold shipping conditions followed by 2 days at 37°C culture. The flask of islets are verification in the event of a dispute over sterility or islet quality.

Proper citation: Integrated Islet Distribution Program 2020. Sentinel Flask Preparation for Cold Shipping Protocol of Human Islets. protocols.io dx.doi.org/10.17504/protocols.io.bctziwp6 Copy   


  • DOI: 10.17504/protocols.io.iencbde

Authors: Yuejun Wang

Proper citation: Yuejun Wang 2017. Real-time RT-PCR. protocols.io dx.doi.org/10.17504/protocols.io.iencbde Copy   


Authors: Yaowu Yuan
Group: Mimulus
Summary: This protocol is part of a collection for Mimulus in planta transformation.

Proper citation: Yaowu Yuan 2019. Agro Preparation for Mimulus in Planta Transformation. protocols.io dx.doi.org/10.17504/protocols.io.3rqgm5w Copy   


  • DOI: 10.17504/protocols.io.r6xd9fn

Authors: Wen Aw

Proper citation: Wen Aw 2018. Cooking Larvae Diet. protocols.io dx.doi.org/10.17504/protocols.io.r6xd9fn Copy   


  • DOI: 10.17504/protocols.io.ey3bfyn

Authors: Alan J. Cone
Summary: Separates molecules based on size. Great for checking DNA after a Restriction Digest.

Proper citation: Alan J. Cone 2016. Gel Electrophoresis. protocols.io dx.doi.org/10.17504/protocols.io.ey3bfyn Copy   


  • DOI: 10.17504/protocols.io.bjdjki4n

Authors: avinash.kale
Group: UM-DAE Centre for Excellence in Basic Sciences

Proper citation: avinash.kale 2020. SEM imaging of Bacteria. protocols.io dx.doi.org/10.17504/protocols.io.bjdjki4n Copy   


Authors: Jing-Hu Yang, Xiang Yu, Yi Yang, Zeng-Qiang Yang

Proper citation: Jing-Hu Yang, Xiang Yu, Yi Yang, Zeng-Qiang Yang 2018. Physical simulation of ground fissures triggered by underground coal mining. protocols.io dx.doi.org/10.17504/protocols.io.jwycpfw Copy   


Authors: Lixin Wang, Collin Challis, Honghui Liang, Songlin Li, Charless Fowlkes, Aidan Sullivan, Kumar SR, Yvette Taché
Group: SPARC
Summary: Using a multicolor adeno-associate virus system to label the colonic enteric nervous system for digital tracing of individual neurons and nerve fibers in microcircuits in three-dimensions (3D). The methods include viral vectors retro-orbital injection in mice, preparation of colon tissues, microscopy and 3D digital tracing.

Proper citation: Lixin Wang, Collin Challis, Honghui Liang, Songlin Li, Charless Fowlkes, Aidan Sullivan, Kumar SR, Yvette Taché 2020. Multicolor adeno-associate virus labeling and 3D digital tracing of enteric plexus in mouse proximal colon. protocols.io dx.doi.org/10.17504/protocols.io.bqavmse6 Copy   


  • DOI: 10.17504/protocols.io.be8mjhu6

Authors: Silvia Domcke, Andrew J. Hill, Riza M. Daza, Cole Trapnell, Darren A. Cusanovich, Jay Shendure
Group: Human Cell Atlas Method Development Community
Summary: We developed an improved assay for single cell profiling of chromatin accessibility that both uses three levels of combinatorial indexing and, in contrast with previous iterations of sci-ATAC-seq and related methods, does not rely on molecularly barcoded Tn5 complexes (sci-ATAC-seq3). Rather, the first two rounds of indexing are achieved by ligation to either end of the conventional, uniformly loaded Tn5 transposase complex (standard Nextera™), while the final round of indexing remains through PCR. Relative to two-level sci-ATAC-seq but similar to sci-RNA-seq3, sci-ATAC-seq3 reduces the per-cell cost of library preparation as well as the rate of collisions, opening the door to experiments on the scale of 10^6 cells. This protocol no longer requires cell sorting, and we also optimized ligase and polymerase choice, kinase concentration, and oligo designs and concentrations, to maximize the number of fragments recovered from each cell. Of note, while maintaining an enrichment in accessible regions, we made the explicit choice to maximize complexity at the expense of specificity for accessible sites. In particular, we found that the fixation conditions could be tuned to adjust the sensitivity (i.e. complexity) vs. specificity (i.e. enrichment in accessible sites) of the assay.

Proper citation: Silvia Domcke, Andrew J. Hill, Riza M. Daza, Cole Trapnell, Darren A. Cusanovich, Jay Shendure 2020. sci-ATAC-seq3. protocols.io dx.doi.org/10.17504/protocols.io.be8mjhu6 Copy   


Authors: Benjamin Istace, Anne Friedrich, Léo dAgata, Sébastien Faye, Emilie Payen, Odette Beluche, Claudia Caradec, Sabrina Davidas, Corinne Cruaud, Gianni Liti, Arnaud Lemainque, Stefan Engelen, Patrick Wincker, Joseph Schacherer, Jean-Marc Aury
Group: GigaScience Press
Summary: Describes the library preparation for Nanopore sequencing from low input DNA according to the SQK-MAP006 protocolIt accompanies the GigaScience publication:Benjamin Istace, et al. (2017) De novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer. GigaScience...

Proper citation: Benjamin Istace, Anne Friedrich, Léo dAgata, Sébastien Faye, Emilie Payen, Odette Beluche, Claudia Caradec, Sabrina Davidas, Corinne Cruaud, Gianni Liti, Arnaud Lemainque, Stefan Engelen, Patrick Wincker, Joseph Schacherer, Jean-Marc Aury 2017. SQK-MAP006 Low Input protocol for library preparation for Nanopore sequencing. protocols.io dx.doi.org/10.17504/protocols.io.gvwbw7e Copy   



Can't find your Protocol?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific protocol and you know the DOI of the protocol already, it's easier to enter a DOI to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your protocol in the search results, please help us by adding it into the system — it's easy. Create and publish your protocols at Protocols.io.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X