Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Name | Authors | DOI | Group |
Summary |
Associated Publications |
RRIDs used | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DNA Extraction Protocol for Cockroach Gut Microbiota (Adapted from Omega Bio-Tek's E.Z.N.A. Bacterial DNA Kit) Resource Report Resource Website |
Kara Tinker, Elizabeth Ottesen | DOI:10.17504/protocols.io.jz5cp86 | Ottesen Lab | University of Georgia, University of Georgia | 1 | 2017 | Kara Tinker, Elizabeth Ottesen 2017. DNA Extraction Protocol for Cockroach Gut Microbiota (Adapted from Omega Bio-Tek's E.Z.N.A. Bacterial DNA Kit). protocols.io https://dx.doi.org/10.17504/protocols.io.jz5cp86 | 2021-04-15 09:15:43 | ||||
|
Anti-Neu5Gc Antibody Kit Protocol - Western Blot Resource Report Resource Website |
Kelsey Miller | DOI:10.17504/protocols.io.hvrb656 | BioLegend | The Anti-Neu5Gc Antibody Kit contains the essential monospecific polyclonal chicken IgY antibody, along with a negative control primary antibody to detect the presence of Neu5Gc on glycoconjugates by Western blot (WB). Samples to be evaluated are first subjected to SDS-PAGE, followed by transfer to a nitrocellulose or polyvinylidenedifluoride (PVDF) membrane. The membrane is then incubated with affinity-purified polyclonal anti-Neu5Gc to determine the presence of Neu5Gc on the protein of interest.The antibody provided in this kit has been shown to identify as little as 5 pmol of Neu5Gc per ug glycoprotein, which is at or below the current detection limit for conventional analysis by acid release, purification, DMB derivatization, HPLC, and electrospray mass-spectrometry. The Western blot provides additional information in that it confirms that Neu5G is directly linked to the glycoprotein of interest rather than to an accompanying sample component. | BioLegend | http://www.biolegend.com/media_assets/support_protocol/Neu5Gc_Antibody_Kit_Protocols_110813.pdf | 2 | 2017 | Kelsey Miller 2017. Anti-Neu5Gc Antibody Kit Protocol - Western Blot. protocols.io https://dx.doi.org/10.17504/protocols.io.hvrb656 | 2021-04-15 09:15:16 | ||
|
The Colombian Signed Peace Agreement: A Text Mining Analysis of its Comprehension Difficulty Resource Report Resource Website |
Juan C. Correa, María del Pilar García-Chitiva and Gustavo R. García-Vargas | DOI:10.17504/protocols.io.h8db9s6 | Fundación Universitaria Konrad Lorenz. Universidad Pedagógica Nacional, Fundación Universitaria Konrad Lorenz. Universidad Pedagógica Nacional | 1 | 2017 | Juan C. Correa, María del Pilar García-Chitiva and Gustavo R. García-Vargas 2017. The Colombian Signed Peace Agreement: A Text Mining Analysis of its Comprehension Difficulty. protocols.io https://dx.doi.org/10.17504/protocols.io.h8db9s6 | 2021-04-15 09:15:43 | |||||
|
MARVICS: A Robust and Safe Magnetic Nanoparticle based RNA Extraction Method Compatible with Phenol-chloroform Inactivated Infectious Samples Resource Report Resource Website |
Mo Li, Gerardo Ramos-Mandujano | DOI:10.17504/protocols.io.bik4kcyw | Diagnosis and surveillance of emerging pathogens such as SARS-CoV-2 depend on nucleic acid isolation from clinical and environmental samples. Under normal circumstances, samples would be processed using commercial proprietary reagents in Biosafety 2 (BSL-2) or higher facilities. A pandemic at the scale of COVID-19 has caused a global shortage of proprietary reagents and BSL-2 laboratories to safely perform testing. Therefore, alternative solutions are urgently needed to address these challenges. We developed an open-source method called Magneticnanoparticle-Aided Viral RNA Isolation of Contagious Samples (MAVRICS) that is built upon reagents that are either readily available or can be synthesized in any molecular biology laboratory with basic equipment. Unlike conventional methods, MAVRICS works directly in samples inactivated in acid guanidinium thiocyanate-phenol-chloroform (e.g., TRIzol), thus allowing infectious samples to be handled safely without biocontainment facilities. | King Abdullah University of Science and Technology, Laboratory of Stem Cell and Regeneration, Biological and Environmental Science and Engineering Division, King Abdullah University of Science and Technology (KAUST) | https://www.medrxiv.org/content/10.1101/2020.06.28.20141945v1 | 2 | 2020 | Mo Li, Gerardo Ramos-Mandujano 2020. MARVICS: A Robust and Safe Magnetic Nanoparticle based RNA Extraction Method Compatible with Phenol-chloroform Inactivated Infectious Samples. protocols.io https://dx.doi.org/10.17504/protocols.io.bik4kcyw | 2021-04-15 09:15:16 | |||
|
NEBNext Ultra II Ligation Module (NEB # E7595) for NEBNext Ultra II FS DNA Module (NEB # E7810) Resource Report Resource Website |
New England Biolabs, Menna Teffera | DOI:10.17504/protocols.io.4ntgven | New England Biolabs (NEB) | This module is part of the Ultra™ II workflow, and is optimized for use with the NEBNext®Ultra II End Repair/dA-Tailing Module (NEB #E7546), for Illumina®-compatible library construction.The NEBNext Ultra II Ligation Module is optimized for use with the NEBNext Ultra II End Repair/dA-Tailing Module (NEB #E7546) or the NEBNext Ultra II FS DNA Module (NEB #E7810). | New England Biolabs, New England Biolabs | https://www.neb.com/protocols/2017/12/21/protocol-for-use-with-nebnext-ultra-ii-fs-dna-module-e7810-and-nebnext-ultra-ii-ligation-module-e7595 | 1 | 2019 | New England Biolabs, Menna Teffera 2019. NEBNext Ultra II Ligation Module (NEB # E7595) for NEBNext Ultra II FS DNA Module (NEB # E7810). protocols.io https://dx.doi.org/10.17504/protocols.io.4ntgven | 2021-04-15 09:15:43 | ||
|
Script R13: OPF and AMG Analysis Resource Report Resource Website |
HANNIGAN GD, GRICE EA, ET AL. | DOI:10.17504/protocols.io.ejkbckw | VERVE Net, Club Grice | This protocols outlines our definitions of core operational protein families (OPFs), potential auxiliary metabolic genes (AMGs), sharing of genes across anatomical sites, and Bray-Curtis dissimilarity of the OPFs by anatomical site. Based on methods from the following publication:Hannigan, Geoffrey D., et al. "The Human Skin Double-Stranded DNA Virome: Topographical and Temporal Diversity, Genetic Enrichment, and Dynamic Associations with the Host Microbiome." mBio 6.5 (2015): e01578-15. | Kindler L, Stoliartchouk A, Teytelman L, Hurwitz BL, Method-centered digital communities on protocols.io for fast-paced scientific innovation. F1000Research doi: 10.12688/f1000research.9453.2 | DEPARTMENT OF DERMATOLOGY UNIVERSITY OF PENNSYLVANIA, DEPARTMENT OF DERMATOLOGY UNIVERSITY OF PENNSYLVANIA, DEPARTMENT OF DERMATOLOGY UNIVERSITY OF PENNSYLVANIA | http://mbio.asm.org/content/6/5/e01578-15.full | 1 | 2016 | HANNIGAN GD, GRICE EA, ET AL. 2016. Script R13: OPF and AMG Analysis. protocols.io https://dx.doi.org/10.17504/protocols.io.ejkbckw | 2021-04-15 09:15:43 | |
|
STP Imaging Protocol Resource Report Resource Website |
Katie Matho, Kannan U V | DOI:10.17504/protocols.io.sqcedsw | BICCN | Cell type distribution and axon projection mapping - data acquisition and processing | Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory | 1 | 2018 | Katie Matho, Kannan U V 2018. STP Imaging Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.sqcedsw | 2021-04-15 09:15:41 | |||
|
Natural Transformation Resource Report Resource Website |
Franziska Müller, Memduha Muratoglu, Jana Jung | DOI:10.17504/protocols.io.uvcew2w | Following this protocol, V. Natriegens cells can be transformed with linear fragments and plasmids based on natural transformation as described in Multiplex Genome Editing by Natural Transformation (MuGENT) for Synthetic Biology in Vibrio natriegens Dalia et. al, 2017. ACS Synthetic Biology. | iGEM Marburg 2018, iGEM Marburg 2018, iGEM Marburg 2018 | 1 | 2018 | Franziska Müller, Memduha Muratoglu, Jana Jung 2018. Natural Transformation. protocols.io https://dx.doi.org/10.17504/protocols.io.uvcew2w | 2021-04-15 09:15:15 | ||||
|
PCR amplification and restriction fragment length polymorphism analysis of four SNPs (C5178A, A10398G, G13708A, and C13928G) in the mtDNA coding region Resource Report Resource Website |
Feng-ling Xu; Mei Ding; Jun Yao; Zhang-sen Shi; Bao-jie Wang | DOI:10.17504/protocols.io.ipgcdjw | The four SNPs (C5178A, A10398G, G13708A, and C13928G) in the mtDNA coding region were detected using PCR-RFLP analysis. The primers listed in able 2 were used to amplify target fragments. The mismatch method was applied to generate an HpyCH4Ⅲ artificial restriction endonuclease site in the amplified fragment that included the C13928G SNP. The 20 µl PCR reactions contained 2.0 µl 10×buffer, 2 µl 2.5 mM dNTP mix, 2 µl each of R and F PCR primers (10pM each), 0.2 µl of rTaq Enzyme (5 U/µl), and 20 ng of template DNA. PCR was performed under the following cycle conditions: initial denaturation of 94 °C for 5 minutes; followed by 30 cycles of 94 °C denaturation for 30 seconds, annealing at 61-65°C (Table 2) for 30 seconds, and elongation at 72 °C for 30 seconds; followed by a final extension at 72 °C for 5 minutes. PCR products were digested with restriction enzymes (S1 Table), and fragments were detected on 6% polyacrylamide gel. A1Table 2. Primers used for the analysis of mtDNA polymorphisms in the hypervariable region and the coding region. 2Locus Annealing Temperature (°C) Primer Sequences (5ʹ → 3ʹ) 3Hypervariable L15869 F 5' AAAATACTCAAATGGGCCTGTC 3' 4Regions 5 H719 R 5' CGTGGTGATTTAGAGGGTGAAC 3' 6 16539 F 5' ACACGTTCCCCTTAAATAAGAC 3' 7 80 R 5' AGCGTCTCGCAATGCTATCG 3' 85178 61°C 5178 F 5' ATCTCTCCCTCACTAAACGTAAGCCTT 3' 9 5178 R 5' TTAGTATAAAAGGGGAGATAGGTAGGAGTAGC 3' 1010398 64°C 10398 F 5' GCCCTCCTTTTACCCCTACCA 3' 11 10398 R 5' GGGAGGATATGAGGTGTGAGCGAT 3' 1213708 65°C 13708 F 5' TCATCGCTACCTCCCTGACAAG 3' 13 13708 R 5' ATGCTAGGGTAGAATCCGAGTATGTT 3' 1413928 61°C 13928 F 5' TATTCGCAGGATTTCTCATTACTAACAACATTTC 3' 1513928 R 5' AAAATATATAAGGATTGTGCGGTGTGTGACG 3' a 16a Mismatched base. | School of Forensic Medicine, China Medical University, Shenyang, 110122, China | 1 | 2017 | Feng-ling Xu; Mei Ding; Jun Yao; Zhang-sen Shi; Bao-jie Wang 2017. PCR amplification and restriction fragment length polymorphism analysis of four SNPs (C5178A, A10398G, G13708A, and C13928G) in the mtDNA coding region. protocols.io https://dx.doi.org/10.17504/protocols.io.ipgcdjw | 2021-04-15 09:15:19 | ||||
|
Vegan Latkes Resource Report Resource Website |
Lenny Teytelman, Hannah Gershik | DOI:10.17504/protocols.io.bas5ieg6 | This recipe is a traditional Eastern-European Jewish latkes (potato pancakes). It is finely grated, unlike coarse in American latkes. Also, egg turns out to be completely unnecessary, so this is also vegan.(Usually you eat them with sour cream though, and I'm not sure how widely available vegan sour cream is.) | protocols.io, grandmother | 2 | 2019 | Lenny Teytelman, Hannah Gershik 2019. Vegan Latkes. protocols.io https://dx.doi.org/10.17504/protocols.io.bas5ieg6 | 2021-04-15 09:15:19 | ||||
|
Flex-T™ Tetramer and Cell Staining Protocol Resource Report Resource Website |
Sam Li | DOI:10.17504/protocols.io.babeiaje | BioLegend | Using UV-induced peptide exchange, MHC/peptide monomers can be generated with conditional Flex-T™ monomers that harbor peptides of interest in their binding grooves. These new MHC monomers are subsequently multimerized using streptavidin-fluorophore conjugates. The resulting Flex-T™ reagents can be used for staining antigen-specific T cells and flow cytometric analysis. In humans, the MHC molecules are called HLA (Human Leukocyte Antigen). | BioLegend | https://www.biolegend.com/protocols/flex-t-tetramer-preparation-and-flow-cytometry-staining-protocol/4251/ | 3 | 2019 | Sam Li 2019. Flex-T™ Tetramer and Cell Staining Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.babeiaje | 2021-04-15 09:15:19 | ||
|
immunofluorescence analysis of CD31 Resource Report Resource Website |
Momoko Ogitani | DOI:10.17504/protocols.io.iv7ce9n | Daiichi Sankyo Co., Ltd. | 1 | 2017 | Momoko Ogitani 2017. immunofluorescence analysis of CD31. protocols.io https://dx.doi.org/10.17504/protocols.io.iv7ce9n | 2021-04-15 09:15:19 | |||||
|
Bioorthogonal Noncanonical Amino Acid Tagging (BONCAT) incubation - ROCKS Resource Report Resource Website |
Jackie Goordial | DOI:10.17504/protocols.io.utkewkw | Orcutt Deep Biosphere Lab | BONCAT is a technique that allows for the visualization and isolation of metabolically active cells from complex environmental enrichments. This is achieved by incubating a sample with synthetic methionine analogs AHA (l-azidohomoalanine) or HPG (l-homopropargylglycine). Instead of the sulfhydryl side group of methionine , these analogs contain an azide or alkyne functional group, respectively, which can be chemically tagged with a fluorophore using a process termed “click-chemistry”. Throughout the incubation period actively growing cells incorporate these synthetic amino acids into newly synthesized proteins. After harvesting cells from a live enrichment, the cells are tagged with the fluorophore. This allows for microscopic visualization along with FACS-based isolation of the metabolically active cells in a community. Downstream analysis can include single-cell sequencing or metagenomics techniques to determine taxonomy and functions of isolated organisms. Notes: Working with low-biomass samples has an inherent high-risk of contamination. Be mindful of sterility at all times. Perform all work in the biological safety cabinet and make sure to sterilize the hood with UV prior beginning work Some of the BONCAT reagents are light-sensitive, be careful to pay attention to if a particular step in the protocol needs to be performed in the darkThe click-chemictry reaction is very sensitive to oxygen, so take care not to vortex/ introdroduce air unnecessarily Try to plan when you harvest incubations so that you are certain you will be able to perform the click-chemistry process the next morning | orcutt lab protocols | 1 | 2018 | Jackie Goordial 2018. Bioorthogonal Noncanonical Amino Acid Tagging (BONCAT) incubation - ROCKS. protocols.io https://dx.doi.org/10.17504/protocols.io.utkewkw | 2021-04-15 09:15:46 | |||
|
Propidium Iodide Cell Cycle Staining Protocol Resource Report Resource Website |
Kelsey Miller | DOI:10.17504/protocols.io.e2mbgc6 | BioLegend | BioLegend | http://www.biolegend.com/media_assets/support_protocol/PI_Cell_Cycle_Staining_Protocol_V03_04272016.pdf | 1 | 2016 | Kelsey Miller 2016. Propidium Iodide Cell Cycle Staining Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.e2mbgc6 | 2021-04-15 09:15:19 | |||
|
Injection of Viral Tracers by Nanoject Resource Report Resource Website |
Allen Institute for Brain Science | DOI:10.17504/protocols.io.bgpujvnw | BICCN, Allen Institute for Brain Science | This protocol describes the delivery of a neuronal tracer using the Nanoject II. The surgery uses a stereotaxic system to target specific brain coordinates in the mouse. Note: Research reported in this publication was supported by the National Institute Of Mental Health of the National Institutes of Health under Award Number U19MH114830. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. | Allen Institute | 3 | 2020 | Allen Institute for Brain Science 2020. Injection of Viral Tracers by Nanoject. protocols.io https://dx.doi.org/10.17504/protocols.io.bgpujvnw | 2021-04-15 09:15:19 | |||
|
Inhibition immunoassay of the HIVgp120_anti-HIVgp120 (Ab-1) reaction by anti-anti-idiotypic-HIVgp120 antibody (Ab-3). Resource Report Resource Website |
Angel Justiz-Vaillant | DOI:10.17504/protocols.io.bjnqkmdw | University of the West Indies, [email protected] | University of the West Indies St. Augustine | 1 | 2020 | Angel Justiz-Vaillant 2020. Inhibition immunoassay of the HIVgp120_anti-HIVgp120 (Ab-1) reaction by anti-anti-idiotypic-HIVgp120 antibody (Ab-3). . protocols.io https://dx.doi.org/10.17504/protocols.io.bjnqkmdw | 2021-04-15 09:15:45 | ||||
|
LN34 pan-lyssavirus real-time RT-PCR for post-mortem diagnosis of rabies in animals Resource Report Resource Website |
Crystal M. Gigante, Kimberly Wilkins, Rene Edgar Condori Condori, Yu Li | DOI:10.17504/protocols.io.n4tdgwn | PurposeTo describe the LN34 real-time RT-PCR assay procedure used for the qualitative detection of lyssavirus RNA in whole RNA extracted from brain tissue samples. The assay detects RNA from diverse lyssaviruses at varying concentrations [1]. | Gigante CM, Dettinger L, Powell JW, Seiders M, Condori REC, Griesser R, et al. (2018) Multi-site evaluation of the LN34 pan-lyssavirus real-time RT-PCR assay for post-mortem rabies diagnostics. PLoS ONE 13(5): e0197074. https://doi.org/10.1371/journal.pone.0197074 | Poxvirus and Rabies Branch, Division of High Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia, USA, Poxvirus and Rabies Branch, Division of High Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia, USA, Poxvirus and Rabies Branch, Division of High Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia, USA, Poxvirus and Rabies Branch, Division of High Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia, USA | 1 | 2018 | Crystal M. Gigante, Kimberly Wilkins, Rene Edgar Condori Condori, Yu Li 2018. LN34 pan-lyssavirus real-time RT-PCR for post-mortem diagnosis of rabies in animals. protocols.io https://dx.doi.org/10.17504/protocols.io.n4tdgwn | 2021-04-15 09:15:17 | |||
|
Immunoblot based assay for simultaneous densitometric determination of ubiquitin forms in Drosophila melanogaster Resource Report Resource Website |
Ágota Nagy, Levente Kovács, Zoltán Lipinszki, Margit Pál, Péter Deák | DOI:10.17504/protocols.io.s5teg6n | This protocol describes an immunoassay, originally developed to quantitate ubiquitin in mouse tissues (Oh et al., Anal. Biochem. 443, 153–155), which we adapted to Drosophila melanogaster. The method is suitable for the simultaneous determination of total, free and conjugated ubiquitin forms from whole protein extracts by densitometric analysis of Western blots. In this assay, endogenous deubiquitylating enzymes, DUBs, present in the lysates process all conjugated ubiquitins to monoubiquitins, therefore the total ubiquitin content of cell lysates can be determined in the form of monoubiquitins. The free monoubiquitin fraction in turn is determined from similar lysates, but supplemented with a potent DUB inhibitor, NEM. Appropriate samples of these lysates are immunoblotted together with ubiquitin standards that allow the quantification of the different ubiquitin forms by densitometric analysis of the 8,5 kDa monoubiquitin band. | Department of Genetics, University of Szeged, Szeged, Hungary, Department of Genetics, University of Szeged, Szeged, Hungary, Institute of Biochemistry, Biological Research Centre, Szeged, Hungary, Institute of Biochemistry, Biological Research Centre, Szeged, Hungary, Department of Genetics, University of Szeged, Szeged, Hungary | 1 | 2018 | Ágota Nagy, Levente Kovács, Zoltán Lipinszki, Margit Pál, Péter Deák 2018. Immunoblot based assay for simultaneous densitometric determination of ubiquitin forms in Drosophila melanogaster. protocols.io https://dx.doi.org/10.17504/protocols.io.s5teg6n | 2021-04-15 09:15:45 | ||||
|
Extraction of Nuclei from Brain Tissue Resource Report Resource Website |
Laura Bortolin, Melissa Goldman, Steven Mccarroll | DOI:10.17504/protocols.io.2srged6 | McCarroll Lab | This protocol enables rapid isolation of intact nuclei from brain tissue, including highly myelinated adult brain tissue. We have used it successfully to extract nuclei for single-nucleus RNA-seq from human, mouse, marmoset, and macaque brain. | Harvard Medical School; Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard, Harvard Medical School; Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard, Harvard Medical School; Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard | 1 | 2020 | Laura Bortolin, Melissa Goldman, Steven Mccarroll 2020. Extraction of Nuclei from Brain Tissue. protocols.io https://dx.doi.org/10.17504/protocols.io.2srged6 | 2021-04-15 09:15:17 | |||
|
Antibiotics Stock Concentration Resource Report Resource Website |
Bao Thai | DOI:10.17504/protocols.io.mpbc5in | Stephen Floor Lab | University of California, San Francisco | 1 | 2018 | Bao Thai 2018. Antibiotics Stock Concentration. protocols.io https://dx.doi.org/10.17504/protocols.io.mpbc5in | 2021-04-15 09:15:17 |
Can't find your Protocol?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific protocol and you know the DOI of the protocol already, it's easier to enter a DOI to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your protocol in the search results, please help us by adding it into the system — it's easy. Create and publish your protocols at Protocols.io.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
