Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Name | Authors | DOI | Group |
Summary |
Associated Publications |
RRIDs used | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Variant functionalization by localization Resource Report Resource Website |
jessechao | DOI:10.17504/protocols.io.bn68mhhw | University of British Columbia | 1. Department of Cellular and Physiological Sciences, Life Sciences Institute, University of British Columbia, Vancouver, Canada, V6T1Z3 | 1 | 2020 | jessechao 2020. Variant functionalization by localization. protocols.io https://dx.doi.org/10.17504/protocols.io.bn68mhhw | 2021-04-15 09:15:14 | ||||
|
ECOGEO 'Omics Training: 2.0 Quality Control Resource Report Resource Website |
Ben Tully | DOI:10.17504/protocols.io.fixbkfn | ECOGEO | Quality impact results is the universal first step for all sequencing methods. This protocol is for sequencing results in FASTQ format. FastQC allows for visualization of quality scores. Sequence trimming allows for removal of residual primer sequences and increases overall quality scores. Trimmomatic does both. CutAdapt cuts adapters from sequences. Sickle creates a sliding window for quality and length trimming of FASTQ files.Open this protocol inside the virtual machine (details in 'Start Instructions') for easy copy, paste of commands into the command line terminal window. | EarthCube Oceanography and Geobiology Environmental 'Omics | 2 | 2016 | Ben Tully 2016. ECOGEO 'Omics Training: 2.0 Quality Control. protocols.io https://dx.doi.org/10.17504/protocols.io.fixbkfn | 2021-04-15 09:15:14 | |||
|
Universal Immunoblot analysis for investigating Protein-LAG (SpLAG)-binding to mammalian and avian immunoglobulins. Resource Report Resource Website |
Angel Justiz-Vaillant | DOI:10.17504/protocols.io.bjsdkna6 | University of the West Indies, [email protected] | A protein that combines the binding capacity of SpA, SpG and SpL is not comercially available. It was created in my laboratory by combining these 3 immunoglobulin-binding proteins to horseradish peroxidase by the periodate method [1]. However, a mixture of SpA, SpG and SpL which are comercially available can have the same effect as universal reagent in immunodetection. 1. Vaillant AJ, McFarlane-Andersonv N, Wisdom B, Mohammed W, Vuma S, et al. (2013) Immunoglobulin-binding Bacterial Proteins (IBP) Conjugates and their Reactivity with Immunoglobulin in Enzyme-Linked Immunosorbent Assays (ELISA). J Anal Bioanal Tech 4: 175. doi:10.4172/2155-9872.1000175 | University of the West Indies St. Augustine | 1 | 2020 | Angel Justiz-Vaillant 2020. Universal Immunoblot analysis for investigating Protein-LAG (SpLAG)-binding to mammalian and avian immunoglobulins.. protocols.io https://dx.doi.org/10.17504/protocols.io.bjsdkna6 | 2021-04-15 09:15:39 | |||
|
Treseder Lab Pyrosequencing Protocol Resource Report Resource Website |
Treseder K, Holden S, Maltz M | DOI:10.17504/protocols.io.jgacjse | DNA ExtractionExtract DNA from sample using the phenol/chloroform procedure or your kit of choice. We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples.Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction.Dilute DNA to 10 ng/ul prior to PCR. PCR AmplificationPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingExtract DNA from sample using the phenol/chloroform procedure or your kit of choice. We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples.Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction.Dilute DNA to 10 ng/ul prior to PCR. PCR AmplificationPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice PCR AmplificationPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry icePrimer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGAReverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCCPCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNAPCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencing Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry iceSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice | Maltz MR, Treseder KK, McGuire KL (2017) Links between plant and fungal diversity in habitat fragments of coastal shrubland. PLoS ONE 12(9): e0184991. doi: 10.1371/journal.pone.0184991 | UC Irvine, Stanford University, UC Riverside | https://doi.org/10.1371/journal.pone.0184991 | 1 | 2017 | Treseder K, Holden S, Maltz M 2017. Treseder Lab Pyrosequencing Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.jgacjse | 2021-04-15 09:15:41 | ||
|
Bacterial two hybrid analysis Resource Report Resource Website |
Yuan Yao | DOI:10.17504/protocols.io.qaedsbe | Yao Y, Ma Y, Chen X, Bade R, Lv C, Zhu R (2018) Absence of RstA results in delayed initiation of DNA replication in Escherichia coli. PLoS ONE 13(7): e0200688. doi: 10.1371/journal.pone.0200688 | Inner Mongolia People`s Hospital | https://doi.org/10.1371/journal.pone.0200688 | 1 | 2018 | Yuan Yao 2018. Bacterial two hybrid analysis. protocols.io https://dx.doi.org/10.17504/protocols.io.qaedsbe | 2021-04-15 09:15:15 | |||
|
ddRAD-Seq protocol Resource Report Resource Website |
Lara Shepherd | DOI:10.17504/protocols.io.zgyf3xw | Shepherd LD, Brownsey PJ, Stowe C, Newell C, Perrie LR (2019) Genetic and morphological identification of a recurrent Dicksonia tree fern hybrid in New Zealand. PLoS ONE 14(5): e0216903. doi: 10.1371/journal.pone.0216903 | Museum of New Zealand Te Papa Tongarewa | https://doi.org/10.1371/journal.pone.0216903 | 2 | 2019 | Lara Shepherd 2019. ddRAD-Seq protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.zgyf3xw | 2021-04-15 09:15:41 | |||
|
Allende HRTEM study Resource Report Resource Website |
H. I. Cruz-Rosas, F. Riquelme, P. Santiago, L. Rendón, T. Buhse, F. Ortega-Gutiérrez, R. Borja-Urby, D. Mendoza, C. Gaona, P. Miramontes, G. Cocho. | DOI:10.17504/protocols.io.3f4gjqw | SAMPLES. We used a meteorite specimen of 297.8 g in weight, register number IG-A7, from the Colección Nacional de Meteoritas of the Instituto de Geología, Universidad Nacional Autónoma de México (UNAM), Mexico City (figure). For transmission electron microscopy (TEM), a ~ 4 cm long fragment of the large specimen were freshly fractured and cut by using a diamond knife in a clean room. Later, smaller clean fragments (~ 50 mg in total) were extracted from the interior, avoiding contamination from the fusion crust or surface areas. The resulting crude sample were powdered in an agate mortar and suspended in high-purity ethanol to achieve homogeneous dispersion without agglomerates. For HRTEM analysis, a 5µl pipette was add a portion of that suspension to a lacey carbon grid coated with formvar. Before being used, the TEM grid was carefully inspected in order to rule out any possible contamination. HRTEM. High Resolution TEM imaging of chondrite samples was conducted using an Aberration Corrected Cold Field Emission Scanning Transmission Electron Microscope Jeol JEM-ARM200CF at the Centro de Nanociencias y Micro y Nanotecnologías, Instituto Politécnico Nacional, Mexico City. The TEM microscope is equipped with cold field emission gun, Cs-corrector, and high angle annular dark field (HAADF) detector and has ultra-high resolution of 0.72 Å. We utilized an electron beam spot with a condenser aperture of 60 nm at 200 kV for less than 30 seconds. Several locations on individual samples were analyzed. Fast Fourier Transform (FFT) analysis and image processing were applied using the freely available Digital Micrograph (GATAN) software attached at the microscope. | Cruz-Rosas HI, Riquelme F, Santiago P, Rendón L, Buhse T, Ortega-Gutiérrez F, Borja-Urby R, Mendoza D, Gaona C, Miramontes P, Cocho G (2019) Multiwall and bamboo-like carbon nanotubes from the Allende chondrite: A probable source of asymmetry. PLoS ONE 14(7): e0218750. doi: 10.1371/journal.pone.0218750 | Facultad de Ciencias, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico, Laboratorio de Sistemática Molecular. Escuela de Estudios Superiores del Jicarero, Universidad Autónoma del Estado de Morelos, Jicarero CP. 62909, Morelos, Mexico., Instituto de Física, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico., Instituto de Física, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico., Centro de Investigaciones Químicas, Universidad Autónoma del Estado de Morelos, Cuernavaca, CP. 62209, Morelos, Mexico., Instituto de Geología, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico., Centro de Nanociencias y Micro y Nanotecnologías, Instituto Politécnico Nacional, Av. Luis Enrique Erro S/N, Unidad profesional Adolfo López Mateos, Zacatenco, C.P. 07738, Cd. Mx., Mexico., Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico., Facultad de Ciencias, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico, Facultad de Ciencias, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico, Instituto de Física, Universidad Nacional Autónoma de México, Ciudad Universitaria, CP. 04510, Cd. Mx., Mexico. | https://doi.org/10.1371/journal.pone.0218750 | 1 | 2019 | H. I. Cruz-Rosas, F. Riquelme, P. Santiago, L. Rendón, T. Buhse, F. Ortega-Gutiérrez, R. Borja-Urby, D. Mendoza, C. Gaona, P. Miramontes, G. Cocho. 2019. Allende HRTEM study. protocols.io https://dx.doi.org/10.17504/protocols.io.3f4gjqw | 2021-04-15 09:15:15 | ||
|
HuBMAP: Embedding Fixed Frozen OCT Samples Resource Report Resource Website |
Marda Jorgensen, Jerelyn Nick | DOI:10.17504/protocols.io.basniede | Human BioMolecular Atlas Program (HuBMAP) Method Development Community | The purpose of this Standard Operating Procedure (SOP) is to outline procedures for the OCT embedding of HuBMAP frozen fixed specimens. | University of Florida, University of Florida | 1 | 2020 | Marda Jorgensen, Jerelyn Nick 2020. HuBMAP: Embedding Fixed Frozen OCT Samples. protocols.io https://dx.doi.org/10.17504/protocols.io.basniede | 2021-04-15 09:15:15 | |||
|
Measurement of cellular oxygen consumption and extracellular acidification Resource Report Resource Website |
Kiichi Hirota, Yoshiyuki Matsuo | DOI:10.17504/protocols.io.v92e98e | Sumi C, Matsuo Y, Kusunoki M, Shoji T, Uba T, Iwai T, Bono H, Hirota K (2019) Cancerous phenotypes associated with hypoxia-inducible factors are not influenced by the volatile anesthetic isoflurane in renal cell carcinoma. PLoS ONE 14(4): e0215072. doi: 10.1371/journal.pone.0215072 | Kansai Medical University, Kansai Medical University | https://doi.org/10.1371/journal.pone.0215072 | 2 | 2018 | Kiichi Hirota, Yoshiyuki Matsuo 2018. Measurement of cellular oxygen consumption and extracellular acidification. protocols.io https://dx.doi.org/10.17504/protocols.io.v92e98e | 2021-04-15 09:15:14 | |||
|
12% SDS-PAGE Western Blot Resource Report Resource Website |
Grace Basa | DOI:10.17504/protocols.io.rwrd7d6 | Neubig_Lab | This is the protocol for making and running a 12% SDS-PAGE Western blot. Protocol starts from pouring gels all the way to reading the membrane. | MSU Department of Pharmacology & Toxicology | 1 | 2018 | Grace Basa 2018. 12% SDS-PAGE Western Blot . protocols.io https://dx.doi.org/10.17504/protocols.io.rwrd7d6 | 2021-04-15 09:15:14 | |||
|
Making normal NGM for imaging plates (Cabreiro Lab) Resource Report Resource Website |
Saul Moore | Behavioural Genomics | Imperial College London | 1 | 2021 | Saul Moore 2021. Making normal NGM for imaging plates (Cabreiro Lab). protocols.io https:// | 2021-04-15 09:15:14 | |||||
|
Extracellular enzyme assays (NAG, BG, and CBH) Resource Report Resource Website |
Mia Maltz, Allison SD, German D, Looby C. | DOI:10.17504/protocols.io.jf8cjrw | We conducted fluorimetric assays for each of three hydrolytic enzymes: b-glucosidase and cellobiohydrolase, and N-acetyl-glucosaminidase in black microplates. We measured fluorescence at 365 nm excitation and 450 nm emission. From each sample, we recorded fluorescence values for MUB substrate (substrate control), homogenate (homogenate control), MUB standards in the presence of maleate buffer (standard), and MUB in the presence of homogenate. We calculated potential extracellular enzyme activity of NAG, BG, and CBH from each litter sample. | UC Riverside, UC Irvine, UC Irvine, UC Irvine | 1 | 2017 | Mia Maltz, Allison SD, German D, Looby C. 2017. Extracellular enzyme assays (NAG, BG, and CBH). protocols.io https://dx.doi.org/10.17504/protocols.io.jf8cjrw | 2021-04-15 09:15:40 | ||||
|
Sandwich ELISA Protocol Resource Report Resource Website |
Kelsey Knight | DOI:10.17504/protocols.io.tm9ek96 | BioLegend | BioLegend | https://www.biolegend.com/protocols/sandwich-elisa-protocol/4268/ | 2 | 2018 | Kelsey Knight 2018. Sandwich ELISA Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.tm9ek96 | 2021-04-15 09:15:14 | |||
|
RNA Isolation from Plant Tissue Protocol 5: pBIOZOL Method Resource Report Resource Website |
Eric Carpenter | DOI:10.17504/protocols.io.4rdgv26 | GigaScience Press, BGI | Implemented by: Beijing Genomics InstituteThis protocol is part of a collection of eighteen protocols used to isolate total RNA from plant tissue. (RNA Isolation from Plant Tissue Collection: https://www.protocols.io/view/rna-isolation-from-plant-tissue-439gyr6) | 1 | 2019 | Eric Carpenter 2019. RNA Isolation from Plant Tissue Protocol 5: pBIOZOL Method. protocols.io https://dx.doi.org/10.17504/protocols.io.4rdgv26 | 2021-04-15 09:15:40 | ||||
|
SILICONE INDUCED GRANULOMA OF BREAST IMPLANT CAPSULE Resource Report Resource Website |
Eduardo Fleury | DOI:10.17504/protocols.io.bfn4jmgw | Objective: To evaluate the ability of BMRI to detect silicone gel bleeding in a prospective observational study including consecutive patients referred for a BMRI scan.Methods: From January 2017 until now, patients referred for BMRI were evaluated in a prospective observational study. Patients who had breast implants were included. BMRI recorded 9 findings according to BI-RADS lexicon and SIGBIC findings, considered equivocal features to detect gel bleeding (GB). Three new original imaging features were added for SIGBIC diagnosis: black drop signal; T2* hypersignal mass; and delayed contrast enhancement, considered as irrevocable signs. The presence of silicones corpuscles was confirmed by percutaneous biopsy or surgical capsulectomy. The accuracy of BMRI SIGBIC findings to predict GB was determined. We also used univariate analysis for the equivocal features for GB diagnosis. The Backward method was applied for a multivariate Logistic Regression model for the equivocal features. | Fleury EdFC (2020) Silicone Induced Granuloma of Breast Implant Capsule (SIGBIC) diagnosis: Breast Magnetic Resonance (BMR) sensitivity to detect silicone bleeding. PLoS ONE 15(6): e0235050. doi: 10.1371/journal.pone.0235050 | MD du FLE tele-radiologia | http://medRxiv 2020.01.15.20017350; doi: https://doi.org/10.1101/2020.01.15.20017350 | 1 | 2020 | Eduardo Fleury 2020. SILICONE INDUCED GRANULOMA OF BREAST IMPLANT CAPSULE. protocols.io https://dx.doi.org/10.17504/protocols.io.bfn4jmgw | 2021-04-15 09:15:14 | ||
|
High-fidelity detection of IFN-? secreting CD4 and CD8 cells in response to soluble or Ad5 transduced influenza antigens using ELISPOT and cell sorting Resource Report Resource Website |
Aleksey Pichugin, Alexander Bagaev, Ravshan Ataullakhanov | DOI:10.17504/protocols.io.jn4cmgw | ELISPOT allows detection of single IFN-γ-secreting cell, but the use of unseparated spleen cells removes the advantages of the method due to a high back ground of IFN-γ-production and uncertainty of the phenotype of secreting cells (CD4, CD8 or NK).We used high purity sorted CD4 and CD8 cells.For in vitro restimulation of CD8 T-cells, we used dendritic cells that present antigenic epitopes of M2, NP or of adenovirus in the context of MHC class I. In this instance, dendritic cells were transduced with Ad5-tet-M2, Ad5-tet-NP or Ad5-null, respectively.For restimulation of CD4 T-cells in vitro, we used dendritic cells that present antigenic M2 or NP epitopes in the context of MHC class II. For this purpose, dendritic cells were additionally activated by lipopolysaccharide E. coli (1 μg/ml) and were loaded with recombinant protein NP or M2e peptide.. | Tutykhina I, Esmagambetov I, Bagaev A, Pichugin A, Lysenko A, Shcherbinin D, Sedova E, Logunov D, Shmarov M, Ataullakhanov R, Naroditsky B, Gintsburg A (2018) Vaccination potential of B and T epitope-enriched NP and M2 against Influenza A viruses from different clades and hosts. PLoS ONE 13(1): e0191574. doi: 10.1371/journal.pone.0191574 | NRC Institute of Immunology FMBA of Russia, Moscow, Russia, NRC Institute of Immunology FMBA of Russia, Moscow, Russia, NRC Institute of Immunology FMBA of Russia, Moscow, Russia | https://doi.org/10.1371/journal.pone.0191574 | 1 | 2018 | Aleksey Pichugin, Alexander Bagaev, Ravshan Ataullakhanov 2018. High-fidelity detection of IFN-? secreting CD4 and CD8 cells in response to soluble or Ad5 transduced influenza antigens using ELISPOT and cell sorting. protocols.io https://dx.doi.org/10.17504/protocols.io.jn4cmgw | 2021-04-15 09:15:40 | ||
|
0.5 M EDTA (0.5 L) Resource Report Resource Website |
Haven Himmighoefer | DOI:10.17504/protocols.io.ks7cwhn | Is used in a multitude of experiments, but is often used as an ingredient in 10x TBE buffer | Hesselberth Lab | 1 | 2017 | Haven Himmighoefer 2017. 0.5 M EDTA (0.5 L). protocols.io https://dx.doi.org/10.17504/protocols.io.ks7cwhn | 2021-04-15 09:15:14 | ||||
|
Installing Anvi'o using a Docker Image Resource Report Resource Website |
James Thornton | DOI:10.17504/protocols.io.gejbtcn | Hurwitz Lab, MetaFunc Course | 3 | 2016 | James Thornton 2016. Installing Anvi'o using a Docker Image. protocols.io https://dx.doi.org/10.17504/protocols.io.gejbtcn | 2021-04-15 09:15:39 | |||||
|
Optimized protocol for quantification of nitrite levels in brain and head kidney tissue samples in adult zebrafish Resource Report Resource Website |
Caio Maximino, Jeisiane Souza de Oliveira, Monica Gomes Lima-Maximino | DOI:10.17504/protocols.io.sabeaan | Fish behavior and physiology | Zebrafish, and other small teleosts, are used as experimental models to evaluate human pathologies, including those linked to oxidative and nitrosative stress, inflammation, and nitric oxide signaling. The protocol presents an optimized technique to quantify nitrite levels, in zebrafish tissues, focusing on the brain and head kidney. The protocol is based on the classical Griess diazotization reaction (Griess, 1858) method. | Universidade Federal do Sul e Sudeste do Pará, Universidade do Estado do Pará, Universidade do Estado do Pará | 1 | 2018 | Caio Maximino, Jeisiane Souza de Oliveira, Monica Gomes Lima-Maximino 2018. Optimized protocol for quantification of nitrite levels in brain and head kidney tissue samples in adult zebrafish. protocols.io https://dx.doi.org/10.17504/protocols.io.sabeaan | 2021-04-15 09:15:40 | |||
|
UPLC-MS/MS procedures of lipidomics for plasma Resource Report Resource Website |
Chunwei Zeng, Guixue Hou | DOI:10.17504/protocols.io.imncc5e | Metabolomics Protocols & Workflows | BGI, BGI | 1 | 2017 | Chunwei Zeng, Guixue Hou 2017. UPLC-MS/MS procedures of lipidomics for plasma. protocols.io https://dx.doi.org/10.17504/protocols.io.imncc5e | 2021-04-15 09:15:39 |
Can't find your Protocol?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific protocol and you know the DOI of the protocol already, it's easier to enter a DOI to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your protocol in the search results, please help us by adding it into the system — it's easy. Create and publish your protocols at Protocols.io.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
