Protocols   Select Another Resource Report Type

Authors: Jernej Turnsek, Pardis Gholami
Group: Protist Research to Optimize Tools in Genetics (PROT-G)
Summary: This protocol presents a Gibson Assembly design for highly efficient construction of diatom episomes. We regularly observe >90% efficiency (efficiency = % of screened bacterial colonies containing the desired construct) following the steps presented here.

Proper citation: Jernej Turnsek, Pardis Gholami 2017. Guidelines for highly efficient construction of diatom episomes using Gibson Assembly . protocols.io dx.doi.org/10.17504/protocols.io.jy7cpzn Copy   

•   Source: Protocols.io

Authors: Stephane Chaillou
Summary: Food Microbiome dataset for comparison of 16S V3-V4 rDNA amplicon sequencing and gyrB amplicon sequencing.

Proper citation: Stephane Chaillou 2018. POIRIER_ET_AL_FOODMICROBIOME_16S_GYRB_DATASET. protocols.io dx.doi.org/10.17504/protocols.io.szref56 Copy   

•   Source: Protocols.io

Authors: Heather Eckart, Ran Zhou, Nadia Khan
Group: Human Cell Atlas Method Development Community, Helmsley project_Basu lab
Summary: This protocol provides a procedure for human intestinal organoid dissociation into a single cell suspension and nuclei isolation prior to Single Cell ATAC-Sequencing.

Proper citation: Heather Eckart, Ran Zhou, Nadia Khan 2020. Intestinal Organoid Dissociation and Nuclei Isolation for Single Cell ATAC-Seq. protocols.io dx.doi.org/10.17504/protocols.io.bmdbk22n Copy   

•   Source: Protocols.io

Authors: Ruben M Costa, Anny Cárdenas, Christian Voolstra
Group: reefgenomics, Aiptasia-Symbiodiniaceae Model System
Summary: This protocol aims to obtain bacteria-depleted Aiptasia polyps. It is divided into 2 sections: (1) a rearing protocol composed of sterile food preparation and anemone priming and (2) a bacteria-depletion protocol for Aiptasia.

Proper citation: Ruben M Costa, Anny Cárdenas, Christian Voolstra 2019. Protocol for bacterial depletion of Aiptasia anemones - Towards the generation of gnotobiotic/germ-free cnidarian host animals. protocols.io dx.doi.org/10.17504/protocols.io.7mrhk56 Copy   

•   Source: Protocols.io

Authors: jnesvet
Summary: The Stanford University and Purigen Biosystems team's SARS-CoV-2 assay leverages on-chip microfluidics to eliminate laborious and time consuming steps associated with standard molecular diagnostics such as solid phase spin-column extraction and PCR amplification. Purification of nucleic acids from a variety of biological sources is achieved in a one-step, automated fashion using on-chip isotachophoresis (ITP). The purified nucleic acids are then amplified using reverse transcription (RT) loop-mediated isothermal amplification (LAMP) in 30 minutes, less than half of the time associated with standard qPCR. We then use CRISPR-Cas12 fluorescent detection to identify amplicons associated with the SARS-CoV-2 genome for enhanced specificity. 

Proper citation: jnesvet 2021. Stanford and Purigen Biosystems Microfluidics Team protocol XPRIZE updated. protocols.io dx.doi.org/10.17504/protocols.io.bqzrmx56 Copy   

•   Source: Protocols.io

Authors: Angel Justiz-Vaillant
Summary: Interleukins (IL) are a type of cytokine first thought to be expressed by leukocytes alone but have later been found to be produced by many other body cells. They play essential roles in the activation and differentiation of immune cells, as well as proliferation, maturation, migration, and adhesion. They also have pro-inflammatory and anti-inflammatory properties. The primary function of interleukins is, therefore, to modulate growth, differentiation, and activation during inflammatory and immune responses. Interleukins consist of a large group of proteins that can elicit many reactions in cells and tissues by binding to high-affinity receptors in cell surfaces. [1]The immunoregulatory cytokine IL-41 (also known as meteorin-like protein) is expressed at high levels in the synovium of patients with psoriatic arthritis (PsA).[2]Reference1. Justiz Vaillant AA, Qurie A. Interleukin. In:StatPearls. Treasure Island (FL): StatPearls Publishing; June 12, 2019.2.Onuora S. Novel cytokine, IL-41, linked with PsA.Nat Rev Rheumatol. 2019;15(11):636. doi:10.1038/s41584-019-0314-7

Proper citation: Angel Justiz-Vaillant 2020. ELISA for quantification of IL-11 in human serum.. protocols.io dx.doi.org/10.17504/protocols.io.bkbsksne Copy   

•   Source: Protocols.io

Authors: Ana Ximena Kiguen, Jessica Paola Mosmann, Raul Fernando Venezuela, Cecilia Gabriela Cuffini
Summary: OmpA gene PCR: PCR DNA extract (5 μl) was used to amplify a 1087 pb fragment of the ompA gene of C. trachomatis, using primers NRO (5’CTCAACTGTAACTGCGTATTT3’) and NLO (5’ATGAAAAAACTCTTGAAATCG3´). PCR amplification processes commenced with a 4-minute denaturation step at 95°C and continued with 49 amplification cycles. Each cycle consisted of a first denaturation step at 95°C for 1 min, an annealing step at 55°C for 1 min and a final step of chain elongation at 72° C for 1.5 min. .justify:after { content: ""; display:inline-block; width: 100%; } Cryptic Plasmid PCR: The primers used to generate a 201-bp fragment from the cryptic plasmid of C. trachomatis were CTP1 (5'-TAGTAACTGCCAClTCATCA-3') and CTP2 (5'-TTCCCCTTGTAATTCGTTGC-3'). The PCR amplification consisted of DNA denaturation at 95°C for 4 min followed by 35 cycles of amplification. Each cycle consisted of 1 min at 95°C, 1 min at 55°C and 1.5 min at 72°C followed by a final elongation at 72°C for 4 min. The ompA gene and cryptic plasmid PCR products were visualized after electrophoresis in a 1% agarose gel by ECO-Gel 20.000X Highway staining. Positive and negative controls were used in all determinations of PCR. .justify:after { content: ""; display:inline-block; width: 100%; }

Proper citation: Ana Ximena Kiguen, Jessica Paola Mosmann, Raul Fernando Venezuela, Cecilia Gabriela Cuffini 2019. Chlamydia trachomatis PCR. protocols.io dx.doi.org/10.17504/protocols.io.zeef3be Copy   

•   Source: Protocols.io

Authors: Zhujun Wei
Group: 2020 iGEM NEFU China

Proper citation: Zhujun Wei 2020. DNT Detection In Soil. protocols.io dx.doi.org/10.17504/protocols.io.bnydmfs6 Copy   

•   Source: Protocols.io

Authors: Franziska Aron, Guido Brandt
Group: WarinnerGroup, MPI-SHH Archaeogenetics
Summary: This protocol describes the amplification procedure of dual-indexed double-stranded DNA libraries, for shotgun Illumina sequencing. It is typically used for libraries indexed using the following protocol: (https://dx.doi.org/10.17504/protocols.io.bakticwn)

Proper citation: Franziska Aron, Guido Brandt 2020. Amplification and Pooling . protocols.io dx.doi.org/10.17504/protocols.io.beqkjduw Copy   

•   Source: Protocols.io

Authors: Qi Wang, Qiang Sun, Xiaoping Li, Zhefeng Wang, Haotian Zheng, Yanmei Ju, Ruijin Guo, Songlin Peng, Huijue Jia
Group: BGI, GIGA, GigaScience Press
Summary: Bone mass loss contributes to the risk of bone fracture in the elderly. Many factors including age, obesity, estrogen and diet, are associated with bone mass loss. Mice studies suggested that the gut microbiome might affect the bone mass by regulating the immune system, however there has been little evidence from human studies. Bone loss increases after menopause. Therefore, we have recruited 361 Chinese post-menopausal women to collect their fecal samples and metadata to conduct metagenome-wide association study (MWAS) to investigate the influence of the gut microbiome on bone health. Gut microbiome sequencing data were produced using BGISEQ500 sequencing, Bone mineral density (BMD) was calculated using Hologic dual energy X-ray machine, body mass index (BMI) and age were also recorded.This collected data allows exploration of the gut microbial diversity and their links to bone mass loss, as well as microbial markers for bone mineral density. In addition, these data are potentially useful in studying the role the gut microbiota might play in bone mass loss and in exploring the bone mass loss process.

Proper citation: Qi Wang, Qiang Sun, Xiaoping Li, Zhefeng Wang, Haotian Zheng, Yanmei Ju, Ruijin Guo, Songlin Peng, Huijue Jia 2021. Protocols for "Linking gut microbiome to bone mineral density: a shotgun metagenomic dataset from 361 elderly women". protocols.io dx.doi.org/10.17504/protocols.io.bq9kmz4w Copy   

•   Source: Protocols.io

Authors: Gabriel Sanchez, Rosemary Kiernan
Summary: This protocol can be ued for chromatin immunoprecipitation of RNAPII and associated factors, as well as histones. The settings are given for HeLa cells and should be adapted for other cell types. 

Proper citation: Gabriel Sanchez, Rosemary Kiernan 2018. Chromatin immunoprecipitation. protocols.io dx.doi.org/10.17504/protocols.io.knkcvcw Copy   

•   Source: Protocols.io

Authors: New England Biolabs
Group: New England Biolabs (NEB)

Proper citation: New England Biolabs 2015. Digestion Mixture for M0302. protocols.io dx.doi.org/10.17504/protocols.io.cqrvv5 Copy   

•   Source: Protocols.io

Authors: Marco Cosentino, Elisa Storelli, Alessandra Luini, Emanuela Rasini, Massimiliano Legnaro, Marco Ferrari, Franca Marino
Summary: Separation of Human Neutrophils (PMN) from Buffy Coat: list of published papers using this protocol- Boydum A. Isolation of mononuclear cells and granulocytes from human blood. Scand.J.Clin.Lab. Invest. 21 (Suppl.97): 77-89, 1968- Alex Mabou Tagne, Franca Marino, Massimiliano Legnaro, Alessandra Luini, Barbara Pacchetti and Marco Cosentino. A Novel Standardized Cannabis sativa L. Extract and Its Constituent Cannabidiol Inhibit Human Polymorphonuclear Leukocyte Functions. Int J Mol Sci2019 Apr; 20(8): 1833. Published online 2019 Apr 13. doi: 10.3390/ijms20081833.- Angela Scanzano, Laura Schembri, Emanuela Rasini, Alessandra Luini, Jessica Dallatorre, Massimiliano Legnaro, Raffaella Bombelli, Terenzio Congiu, Marco Cosentino, Franca Marino. Adrenergic Modulation of Migration, CD11b and CD18 Expression, ROS and interleukin-8 Production by Human Polymorphonuclear Leukocytes. Inflamm Res. 2015 Feb;64(2):127-35. doi: 10.1007/s00011-014-0791-8. Epub 2015 Jan 6.

Proper citation: Marco Cosentino, Elisa Storelli, Alessandra Luini, Emanuela Rasini, Massimiliano Legnaro, Marco Ferrari, Franca Marino 2020. PMN- 01a - Isolation of Human PMN from Buffy Coat. protocols.io dx.doi.org/10.17504/protocols.io.biamkac6 Copy   

•   Source: Protocols.io

Authors: John H. Paul and Markus Weinbauer
Group: VERVE Net
Summary: These are protocols from: Paul, J. H., and M. Weinbauer. 2010. Detection of lysogeny in marine environments, p. 30–33. In S. W. Wilhelm, M. G. Weinbauer, and C. A. Suttle [eds.], Manual of Aquatic Viral Ecology. ASLO.Please see the published manuscript for additional information.

Proper citation: John H. Paul and Markus Weinbauer 2016. Detection of Lysogeny in Marine Environments. protocols.io dx.doi.org/10.17504/protocols.io.ebjbakn Copy   

•   Source: Protocols.io

Authors: Andrew Adey, Casey Thornton
Summary: High-throughput single cell genomic assays resolve the heterogeneity of cell states in complex tissues, however, the spatial orientation within the network of interconnected cells is lost. As cell localization is a necessary dimension in understanding complex tissues and disease states, we present a tool for highly scalable spatially-resolved single cell profiling of chromatin state. We use high density multiregional sampling to perform single-cell combinatorial indexing on Microbiopsies Assigned to Positions for the Assay for Transposase Accessible Chromatin (sciMAP-ATAC) to produce single-cell data of equivalent quality to non-spatial single-cell ATAC-seq.

Proper citation: Andrew Adey, Casey Thornton 2020. sciMAP-ATAC. protocols.io dx.doi.org/10.17504/protocols.io.5r4g58w Copy   

•   Source: Protocols.io

Authors: Eftychis Frangedakis, Marta Tomaselli, Marius Rebmann, Susana Sauret-Gueto
Group: OpenPlant Project
Summary: This protocol allows for quick and dirty genomic DNA extraction. It can easily be used for genotyping with PCR. The quality of the genomic DNA extracted is not suitable for any other application.It has been widely used in different plant species including Marchantia as in https://www.nature.com/articles/srep01532

Proper citation: Eftychis Frangedakis, Marta Tomaselli, Marius Rebmann, Susana Sauret-Gueto 2020. Marchantia genotyping (quick and dirty genomic DNA extraction). protocols.io dx.doi.org/10.17504/protocols.io.bcmwiu7e Copy   

•   Source: Protocols.io

Authors: April Hill, Ivy Nguyen, Malcolm Hill
Summary: A variety of green algal species form intracellular symbioses with freshwater sponges. These sponges and their algal symbionts play important roles in freshwater ecosystems and provide a model for asking questions about freshwater endosymbioses involving heterotrophic animal hosts in mutalistic relationships with photosynthesizing algae. The freshwater sponge Ephydatia muelleri, for example, has a fully sequenced chromosomal level genome as well as many features that make it ammenable to cellular and molecular studies. Here, we provide a simple protocol for isolating green algae from freshwater sponge host tissues. In most cases, microalgae can be cultured outside of the host in commericially available algal medium and on agar substrates. We also describe methods for infecting algal-free sponges hatched from gemmules to establish stable symbioses in juvenile sponges.

Proper citation: April Hill, Ivy Nguyen, Malcolm Hill 2020. Isolation of green algal symbionts from freshwater sponges and subsequent reinfection of sponge tissues. protocols.io dx.doi.org/10.17504/protocols.io.bmuzk6x6 Copy   

•   Source: Protocols.io

Authors: Matus Valach
Summary: A simple protocol for RNA extraction from various types of samples (protists, fungi, bacteria, organelles, subcellular fractions, ribosomes, etc.). Compared to the commercial Trizol® procedure, it makes use of generally available chemicals without the need for columns, thus allowing concurrent extraction of transcripts of all sizes (including RNAs et al. (DOI: 10.1007/978-1-60327-136-3_3).

Proper citation: Matus Valach 2016. RNA extraction using the 'home-made' Trizol substitute. protocols.io dx.doi.org/10.17504/protocols.io.eiebcbe Copy   

•   Source: Protocols.io

Authors: Dan Richter
Group: Ecology of Marine Plankton (ECOMAP) team - Roscoff, Protist Research to Optimize Tools in Genetics (PROT-G)
Summary: February, 2012, based on RNAqueous May 29, 2008 protocol revision C, TURBO DNA-free June 9, 2009 protocol 1907M revision F, phenol/chloroform protocol (http://cshprotocols.cshlp.org/content/2010/6/pdb.prot5438.full), ethanol precipitation protocol (http://cshprotocols.cshlp.org/content/2010/6/pdb.prot5440.full)

Proper citation: Dan Richter 2017. RNAqueous with DNAse Clean-up by Phenol:Chloroform. protocols.io dx.doi.org/10.17504/protocols.io.iskcecw Copy   

•   Source: Protocols.io

Authors: Paul Dény, Frédéric Le Gal, Ségolène Brichler, Athénais Gerber, Paul Dény
Summary: PreC-C Primers encompass described PreC-C mutations: mutation G1896A in the PreC region and mutations A1762T and G1764A in C-gene promotor. Primers were modified according to literature-based alignment, in order to optimize the amplification of all HBV genotypes. Sequence analysis at position 1762, 1764 et 1896 allows to determine sample wild type or mutant sequence (i.e. HBeAg expression or not, respectively). It is also possible to describe others rare punctual mutations. Furthermore, the sequence analysis also allows assessing HBV genotyping.

Proper citation: Paul Dény, Frédéric Le Gal, Ségolène Brichler, Athénais Gerber, Paul Dény 2018. HBV DNA preC/C amplification. protocols.io dx.doi.org/10.17504/protocols.io.mixc4fn Copy   

•   Source: Protocols.io