Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Name | Authors | DOI | Group |
Summary |
Associated Publications |
RRIDs used | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Guidelines for highly efficient construction of diatom episomes using Gibson Assembly Resource Report Resource Website |
Jernej Turnsek, Pardis Gholami | 10.17504/protocols.io.jy7cpzn | Protist Research to Optimize Tools in Genetics (PROT-G) | This protocol presents a Gibson Assembly design for highly efficient construction of diatom episomes. We regularly observe >90% efficiency (efficiency = % of screened bacterial colonies containing the desired construct) following the steps presented here. | University of California, Berkeley, UC San Diego, Scripps Institution of Oceanography (SIO) | J. Craig Venter Institute (JCVI) | 1 | 2017 | Jernej Turnsek, Pardis Gholami 2017. Guidelines for highly efficient construction of diatom episomes using Gibson Assembly . protocols.io dx.doi.org/10.17504/protocols.io.jy7cpzn | 2021-03-29 03:09:25 | |||
|
POIRIER_ET_AL_FOODMICROBIOME_16S_GYRB_DATASET Resource Report Resource Website |
Stephane Chaillou | 10.17504/protocols.io.szref56 | Food Microbiome dataset for comparison of 16S V3-V4 rDNA amplicon sequencing and gyrB amplicon sequencing. | INRA | 2 | 2018 | Stephane Chaillou 2018. POIRIER_ET_AL_FOODMICROBIOME_16S_GYRB_DATASET. protocols.io dx.doi.org/10.17504/protocols.io.szref56 | 2021-03-29 03:09:24 | ||||
|
Intestinal Organoid Dissociation and Nuclei Isolation for Single Cell ATAC-Seq Resource Report Resource Website |
Heather Eckart, Ran Zhou, Nadia Khan | 10.17504/protocols.io.bmdbk22n | Human Cell Atlas Method Development Community, Helmsley project_Basu lab | This protocol provides a procedure for human intestinal organoid dissociation into a single cell suspension and nuclei isolation prior to Single Cell ATAC-Sequencing. | University of Chicago, University of Chicago, University of Chicago | 1 | 2020 | Heather Eckart, Ran Zhou, Nadia Khan 2020. Intestinal Organoid Dissociation and Nuclei Isolation for Single Cell ATAC-Seq. protocols.io dx.doi.org/10.17504/protocols.io.bmdbk22n | 2021-03-29 03:09:24 | |||
|
Protocol for bacterial depletion of Aiptasia anemones - Towards the generation of gnotobiotic/germ-free cnidarian host animals Resource Report Resource Website |
Ruben M Costa, Anny Cárdenas, Christian Voolstra | 10.17504/protocols.io.7mrhk56 | reefgenomics, Aiptasia-Symbiodiniaceae Model System | This protocol aims to obtain bacteria-depleted Aiptasia polyps. It is divided into 2 sections: (1) a rearing protocol composed of sterile food preparation and anemone priming and (2) a bacteria-depletion protocol for Aiptasia. | Red Sea Research Center, Division of Biological and Environmental Science and Engineering, King Abdullah University of Science and Technology (KAUST), Thuwal, Saudi Arabia, Department of Biology, University of Konstanz, 78457 Konstanz, Germany, Department of Biology, University of Konstanz, 78457 Konstanz, Germany | 2 | 2019 | Ruben M Costa, Anny Cárdenas, Christian Voolstra 2019. Protocol for bacterial depletion of Aiptasia anemones - Towards the generation of gnotobiotic/germ-free cnidarian host animals. protocols.io dx.doi.org/10.17504/protocols.io.7mrhk56 | 2021-03-29 03:09:24 | |||
|
Stanford and Purigen Biosystems Microfluidics Team protocol XPRIZE updated Resource Report Resource Website |
jnesvet | 10.17504/protocols.io.bqzrmx56 | The Stanford University and Purigen Biosystems team's SARS-CoV-2 assay leverages on-chip microfluidics to eliminate laborious and time consuming steps associated with standard molecular diagnostics such as solid phase spin-column extraction and PCR amplification. Purification of nucleic acids from a variety of biological sources is achieved in a one-step, automated fashion using on-chip isotachophoresis (ITP). The purified nucleic acids are then amplified using reverse transcription (RT) loop-mediated isothermal amplification (LAMP) in 30 minutes, less than half of the time associated with standard qPCR. We then use CRISPR-Cas12 fluorescent detection to identify amplicons associated with the SARS-CoV-2 genome for enhanced specificity. | Purigen Biosystems, Inc | 1 | 2021 | jnesvet 2021. Stanford and Purigen Biosystems Microfluidics Team protocol XPRIZE updated. protocols.io dx.doi.org/10.17504/protocols.io.bqzrmx56 | 2021-03-29 03:09:24 | ||||
|
ELISA for quantification of IL-11 in human serum. Resource Report Resource Website |
Angel Justiz-Vaillant | 10.17504/protocols.io.bkbsksne | Interleukins (IL) are a type of cytokine first thought to be expressed by leukocytes alone but have later been found to be produced by many other body cells. They play essential roles in the activation and differentiation of immune cells, as well as proliferation, maturation, migration, and adhesion. They also have pro-inflammatory and anti-inflammatory properties. The primary function of interleukins is, therefore, to modulate growth, differentiation, and activation during inflammatory and immune responses. Interleukins consist of a large group of proteins that can elicit many reactions in cells and tissues by binding to high-affinity receptors in cell surfaces. [1]The immunoregulatory cytokine IL-41 (also known as meteorin-like protein) is expressed at high levels in the synovium of patients with psoriatic arthritis (PsA).[2]Reference1. Justiz Vaillant AA, Qurie A. Interleukin. In:StatPearls. Treasure Island (FL): StatPearls Publishing; June 12, 2019.2.Onuora S. Novel cytokine, IL-41, linked with PsA.Nat Rev Rheumatol. 2019;15(11):636. doi:10.1038/s41584-019-0314-7 | University of the West Indies St. Augustine | 1 | 2020 | Angel Justiz-Vaillant 2020. ELISA for quantification of IL-11 in human serum.. protocols.io dx.doi.org/10.17504/protocols.io.bkbsksne | 2021-03-29 03:09:25 | ||||
|
Chlamydia trachomatis PCR Resource Report Resource Website |
Ana Ximena Kiguen, Jessica Paola Mosmann, Raul Fernando Venezuela, Cecilia Gabriela Cuffini | 10.17504/protocols.io.zeef3be | OmpA gene PCR: PCR DNA extract (5 μl) was used to amplify a 1087 pb fragment of the ompA gene of C. trachomatis, using primers NRO (5’CTCAACTGTAACTGCGTATTT3’) and NLO (5’ATGAAAAAACTCTTGAAATCG3´). PCR amplification processes commenced with a 4-minute denaturation step at 95°C and continued with 49 amplification cycles. Each cycle consisted of a first denaturation step at 95°C for 1 min, an annealing step at 55°C for 1 min and a final step of chain elongation at 72° C for 1.5 min. .justify:after { content: ""; display:inline-block; width: 100%; } Cryptic Plasmid PCR: The primers used to generate a 201-bp fragment from the cryptic plasmid of C. trachomatis were CTP1 (5'-TAGTAACTGCCAClTCATCA-3') and CTP2 (5'-TTCCCCTTGTAATTCGTTGC-3'). The PCR amplification consisted of DNA denaturation at 95°C for 4 min followed by 35 cycles of amplification. Each cycle consisted of 1 min at 95°C, 1 min at 55°C and 1.5 min at 72°C followed by a final elongation at 72°C for 4 min. The ompA gene and cryptic plasmid PCR products were visualized after electrophoresis in a 1% agarose gel by ECO-Gel 20.000X Highway staining. Positive and negative controls were used in all determinations of PCR. .justify:after { content: ""; display:inline-block; width: 100%; } | Kiguen AX, Marramá M, Ruiz S, Estofan P, Venezuela RF, Mosmann JP, Monetti MS, Rivero V, Cuffini CG (2019) Prevalence, risk factors and molecular characterization of Chlamydia trachomatis in pregnant women from Córdoba, Argentina: A prospective study. PLoS ONE 14(5): e0217245. doi: 10.1371/journal.pone.0217245 | Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina, Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina, Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina, Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina | https://doi.org/10.1371/journal.pone.0217245 | 1 | 2019 | Ana Ximena Kiguen, Jessica Paola Mosmann, Raul Fernando Venezuela, Cecilia Gabriela Cuffini 2019. Chlamydia trachomatis PCR. protocols.io dx.doi.org/10.17504/protocols.io.zeef3be | 2021-03-29 03:09:25 | ||
|
DNT Detection In Soil Resource Report Resource Website |
Zhujun Wei | 10.17504/protocols.io.bnydmfs6 | 2020 iGEM NEFU China | 2020 iGEM NEFU China | 1 | 2020 | Zhujun Wei 2020. DNT Detection In Soil. protocols.io dx.doi.org/10.17504/protocols.io.bnydmfs6 | 2021-03-29 03:09:25 | ||||
|
Amplification and Pooling Resource Report Resource Website |
Franziska Aron, Guido Brandt | 10.17504/protocols.io.beqkjduw | WarinnerGroup, MPI-SHH Archaeogenetics | This protocol describes the amplification procedure of dual-indexed double-stranded DNA libraries, for shotgun Illumina sequencing. It is typically used for libraries indexed using the following protocol: (https://dx.doi.org/10.17504/protocols.io.bakticwn) | Max Planck Institute for the Science of Human History, Max Planck Institute for the Science of Human History | 1 | 2020 | Franziska Aron, Guido Brandt 2020. Amplification and Pooling . protocols.io dx.doi.org/10.17504/protocols.io.beqkjduw | 2021-03-29 03:09:25 | |||
|
Protocols for "Linking gut microbiome to bone mineral density: a shotgun metagenomic dataset from 361 elderly women" Resource Report Resource Website |
Qi Wang, Qiang Sun, Xiaoping Li, Zhefeng Wang, Haotian Zheng, Yanmei Ju, Ruijin Guo, Songlin Peng, Huijue Jia | 10.17504/protocols.io.bq9kmz4w | BGI, GIGA, GigaScience Press | Bone mass loss contributes to the risk of bone fracture in the elderly. Many factors including age, obesity, estrogen and diet, are associated with bone mass loss. Mice studies suggested that the gut microbiome might affect the bone mass by regulating the immune system, however there has been little evidence from human studies. Bone loss increases after menopause. Therefore, we have recruited 361 Chinese post-menopausal women to collect their fecal samples and metadata to conduct metagenome-wide association study (MWAS) to investigate the influence of the gut microbiome on bone health. Gut microbiome sequencing data were produced using BGISEQ500 sequencing, Bone mineral density (BMD) was calculated using Hologic dual energy X-ray machine, body mass index (BMI) and age were also recorded.This collected data allows exploration of the gut microbial diversity and their links to bone mass loss, as well as microbial markers for bone mineral density. In addition, these data are potentially useful in studying the role the gut microbiota might play in bone mass loss and in exploring the bone mass loss process. | BGI-Shenzhen, Shenzhen 518083, China;School of Future Technology, University of Chinese Academy of Sciences, Beijing, 101408, China., BGI-Shenzhen, Shenzhen 518083, China;Department of Statistical Sciences, University of Toronto, Toronto, Canada, BGI-Shenzhen, Shenzhen 518083, China, Department of Spine Surgery, Shenzhen People's Hospital, Ji Nan University Second College of Medicine, 518020, Shenzhen, China., BGI-Shenzhen, Shenzhen 518083, China;School of Future Technology, University of Chinese Academy of Sciences, Beijing, 101408, China., BGI-Shenzhen, Shenzhen 518083, China;School of Future Technology, University of Chinese Academy of Sciences, Beijing, 101408, China., BGI-Shenzhen, Shenzhen 518083, China;Macau University of Science and Technology, Taipa, Macau 999078, China, Department of Spine Surgery, Shenzhen People's Hospital, Ji Nan University Second College of Medicine, 518020, Shenzhen, China., BGI-Shenzhen, Shenzhen 518083, China; Shenzhen Key Laboratory of Human Commensal Microorganisms and Health Research, BGI-Shenzhen, Shenzhen 518083, China | 1 | 2021 | Qi Wang, Qiang Sun, Xiaoping Li, Zhefeng Wang, Haotian Zheng, Yanmei Ju, Ruijin Guo, Songlin Peng, Huijue Jia 2021. Protocols for "Linking gut microbiome to bone mineral density: a shotgun metagenomic dataset from 361 elderly women". protocols.io dx.doi.org/10.17504/protocols.io.bq9kmz4w | 2021-03-29 03:09:27 | |||
|
Chromatin immunoprecipitation Resource Report Resource Website |
Gabriel Sanchez, Rosemary Kiernan | 10.17504/protocols.io.knkcvcw | This protocol can be ued for chromatin immunoprecipitation of RNAPII and associated factors, as well as histones. The settings are given for HeLa cells and should be adapted for other cell types. | Contreras X, Salifou K, Sanchez G, Helsmoortel M, Beyne E, Bluy L, Pelletier S, Rousset E, Rouquier S, Kiernan R, Nuclear RNA surveillance complexes silence HIV-1 transcription. PLoS Pathogens 14(3). doi: 10.1371/journal.ppat.1006950 | Institut de Genetique Humaine, UMR9002, Montpellier, France, Institut de Genetique Humaine, UMR9002, Montpellier, France | https://doi.org/10.1371/journal.ppat.1006950 | 2 | 2018 | Gabriel Sanchez, Rosemary Kiernan 2018. Chromatin immunoprecipitation. protocols.io dx.doi.org/10.17504/protocols.io.knkcvcw | 2021-03-29 03:09:27 | ||
|
Digestion Mixture for M0302 Resource Report Resource Website |
New England Biolabs | 10.17504/protocols.io.cqrvv5 | New England Biolabs (NEB) | New England Biolabs | https://www.neb.com/protocols/2014/08/11/determining-genome-targeting-efficiency-using-t7-endonuclease-i | 1 | 2015 | New England Biolabs 2015. Digestion Mixture for M0302. protocols.io dx.doi.org/10.17504/protocols.io.cqrvv5 | 2021-03-29 03:09:25 | |||
|
PMN- 01a - Isolation of Human PMN from Buffy Coat Resource Report Resource Website |
Marco Cosentino, Elisa Storelli, Alessandra Luini, Emanuela Rasini, Massimiliano Legnaro, Marco Ferrari, Franca Marino | 10.17504/protocols.io.biamkac6 | Separation of Human Neutrophils (PMN) from Buffy Coat: list of published papers using this protocol- Boydum A. Isolation of mononuclear cells and granulocytes from human blood. Scand.J.Clin.Lab. Invest. 21 (Suppl.97): 77-89, 1968- Alex Mabou Tagne, Franca Marino, Massimiliano Legnaro, Alessandra Luini, Barbara Pacchetti and Marco Cosentino. A Novel Standardized Cannabis sativa L. Extract and Its Constituent Cannabidiol Inhibit Human Polymorphonuclear Leukocyte Functions. Int J Mol Sci2019 Apr; 20(8): 1833. Published online 2019 Apr 13. doi: 10.3390/ijms20081833.- Angela Scanzano, Laura Schembri, Emanuela Rasini, Alessandra Luini, Jessica Dallatorre, Massimiliano Legnaro, Raffaella Bombelli, Terenzio Congiu, Marco Cosentino, Franca Marino. Adrenergic Modulation of Migration, CD11b and CD18 Expression, ROS and interleukin-8 Production by Human Polymorphonuclear Leukocytes. Inflamm Res. 2015 Feb;64(2):127-35. doi: 10.1007/s00011-014-0791-8. Epub 2015 Jan 6. | Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy), Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy), Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy), Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy), Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy), Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy), Center for Research in Medical Pharmacology, University of Insubria (Varese, Italy) | 3 | 2020 | Marco Cosentino, Elisa Storelli, Alessandra Luini, Emanuela Rasini, Massimiliano Legnaro, Marco Ferrari, Franca Marino 2020. PMN- 01a - Isolation of Human PMN from Buffy Coat. protocols.io dx.doi.org/10.17504/protocols.io.biamkac6 | 2021-03-29 03:09:28 | ||||
|
Detection of Lysogeny in Marine Environments Resource Report Resource Website |
John H. Paul and Markus Weinbauer | 10.17504/protocols.io.ebjbakn | VERVE Net | These are protocols from: Paul, J. H., and M. Weinbauer. 2010. Detection of lysogeny in marine environments, p. 30–33. In S. W. Wilhelm, M. G. Weinbauer, and C. A. Suttle [eds.], Manual of Aquatic Viral Ecology. ASLO.Please see the published manuscript for additional information. | Manual of Viral Aquatic Ecology | 1 | 2016 | John H. Paul and Markus Weinbauer 2016. Detection of Lysogeny in Marine Environments. protocols.io dx.doi.org/10.17504/protocols.io.ebjbakn | 2021-03-29 03:09:28 | |||
|
sciMAP-ATAC Resource Report Resource Website |
Andrew Adey, Casey Thornton | 10.17504/protocols.io.5r4g58w | High-throughput single cell genomic assays resolve the heterogeneity of cell states in complex tissues, however, the spatial orientation within the network of interconnected cells is lost. As cell localization is a necessary dimension in understanding complex tissues and disease states, we present a tool for highly scalable spatially-resolved single cell profiling of chromatin state. We use high density multiregional sampling to perform single-cell combinatorial indexing on Microbiopsies Assigned to Positions for the Assay for Transposase Accessible Chromatin (sciMAP-ATAC) to produce single-cell data of equivalent quality to non-spatial single-cell ATAC-seq. | Oregon Health & Science University, Oregon Health & Science University | doi: https://doi.org/10.1101/407668 | 1 | 2020 | Andrew Adey, Casey Thornton 2020. sciMAP-ATAC. protocols.io dx.doi.org/10.17504/protocols.io.5r4g58w | 2021-03-29 03:09:25 | |||
|
Marchantia genotyping (quick and dirty genomic DNA extraction) Resource Report Resource Website |
Eftychis Frangedakis, Marta Tomaselli, Marius Rebmann, Susana Sauret-Gueto | 10.17504/protocols.io.bcmwiu7e | OpenPlant Project | This protocol allows for quick and dirty genomic DNA extraction. It can easily be used for genotyping with PCR. The quality of the genomic DNA extracted is not suitable for any other application.It has been widely used in different plant species including Marchantia as in https://www.nature.com/articles/srep01532 | University of Cambridge, University of Cambridge, Open Plant, Plant Sciences, University of Cambridge, OpenPlant, Plant Sciences, University of Cambridge, OpenPlant | 1 | 2020 | Eftychis Frangedakis, Marta Tomaselli, Marius Rebmann, Susana Sauret-Gueto 2020. Marchantia genotyping (quick and dirty genomic DNA extraction). protocols.io dx.doi.org/10.17504/protocols.io.bcmwiu7e | 2021-03-29 03:09:25 | |||
|
Isolation of green algal symbionts from freshwater sponges and subsequent reinfection of sponge tissues Resource Report Resource Website |
April Hill, Ivy Nguyen, Malcolm Hill | 10.17504/protocols.io.bmuzk6x6 | A variety of green algal species form intracellular symbioses with freshwater sponges. These sponges and their algal symbionts play important roles in freshwater ecosystems and provide a model for asking questions about freshwater endosymbioses involving heterotrophic animal hosts in mutalistic relationships with photosynthesizing algae. The freshwater sponge Ephydatia muelleri, for example, has a fully sequenced chromosomal level genome as well as many features that make it ammenable to cellular and molecular studies. Here, we provide a simple protocol for isolating green algae from freshwater sponge host tissues. In most cases, microalgae can be cultured outside of the host in commericially available algal medium and on agar substrates. We also describe methods for infecting algal-free sponges hatched from gemmules to establish stable symbioses in juvenile sponges. | Department of Biology, Bates College, ME, USA, Department of Biology, Bates College, ME, USA, Department of Biology, Bates College, ME, USA | 1 | 2020 | April Hill, Ivy Nguyen, Malcolm Hill 2020. Isolation of green algal symbionts from freshwater sponges and subsequent reinfection of sponge tissues. protocols.io dx.doi.org/10.17504/protocols.io.bmuzk6x6 | 2021-03-29 03:09:26 | ||||
|
RNA extraction using the 'home-made' Trizol substitute Resource Report Resource Website |
Matus Valach | 10.17504/protocols.io.eiebcbe | A simple protocol for RNA extraction from various types of samples (protists, fungi, bacteria, organelles, subcellular fractions, ribosomes, etc.). Compared to the commercial Trizol® procedure, it makes use of generally available chemicals without the need for columns, thus allowing concurrent extraction of transcripts of all sizes (including RNAs et al. (DOI: 10.1007/978-1-60327-136-3_3). | Université de Montréal, Montreal, Quebec, Canada | 1 | 2016 | Matus Valach 2016. RNA extraction using the 'home-made' Trizol substitute. protocols.io dx.doi.org/10.17504/protocols.io.eiebcbe | 2021-03-29 03:09:31 | ||||
|
RNAqueous with DNAse Clean-up by Phenol:Chloroform Resource Report Resource Website |
Dan Richter | 10.17504/protocols.io.iskcecw | Ecology of Marine Plankton (ECOMAP) team - Roscoff, Protist Research to Optimize Tools in Genetics (PROT-G) | February, 2012, based on RNAqueous May 29, 2008 protocol revision C, TURBO DNA-free June 9, 2009 protocol 1907M revision F, phenol/chloroform protocol (http://cshprotocols.cshlp.org/content/2010/6/pdb.prot5438.full), ethanol precipitation protocol (http://cshprotocols.cshlp.org/content/2010/6/pdb.prot5440.full) |
Richter, Daniel J and Fozouni, Parinaz and Eisen, Michael and King, Nicole. Gene family innovation, conservation and loss on the animal stem lineage. 2018;7:e34226 https://doi.org/10.7554/eLife.34226 |
https://elifesciences.org/articles/34226 | 1 | 2017 | Dan Richter 2017. RNAqueous with DNAse Clean-up by Phenol:Chloroform. protocols.io dx.doi.org/10.17504/protocols.io.iskcecw | 2021-03-29 03:09:30 | ||
|
HBV DNA preC/C amplification Resource Report Resource Website |
Paul Dény, Frédéric Le Gal, Ségolène Brichler, Athénais Gerber, Paul Dény | 10.17504/protocols.io.mixc4fn | PreC-C Primers encompass described PreC-C mutations: mutation G1896A in the PreC region and mutations A1762T and G1764A in C-gene promotor. Primers were modified according to literature-based alignment, in order to optimize the amplification of all HBV genotypes. Sequence analysis at position 1762, 1764 et 1896 allows to determine sample wild type or mutant sequence (i.e. HBeAg expression or not, respectively). It is also possible to describe others rare punctual mutations. Furthermore, the sequence analysis also allows assessing HBV genotyping. | Komas NP, Ghosh S, Abdou-Chekaraou M, Pradat P, Hawajri NA, Manirakiza A, Laghoe GL, Bekondi C, Brichler S, Ouavéné J, Sépou A, Yambiyo BM, Gody JC, Fikouma V, Gerber A, Samarakoon NA, Alfaiate D, Scholtès C, Martel N, Gal FL, Pinto HL, Amri I, Hantz O, Durantel D, Lesbordes J, Gordien E, Merle P, Drugan T, Trépo C, Zoulim F, Cortay J, Kay AC, Dény P (2018) Hepatitis B and hepatitis D virus infections in the Central African Republic, twenty-five years after a fulminant hepatitis outbreak, indicate continuing spread in asymptomatic young adults. PLoS Negl Trop Dis 12(4): e0006377. doi: 10.1371/journal.pntd.0006377 | , , , , Université Paris 13, Centre de Recherches en Cancérilogie de Lyon | https://doi.org/10.1371/journal.pntd.0006377 | 2 | 2018 | Paul Dény, Frédéric Le Gal, Ségolène Brichler, Athénais Gerber, Paul Dény 2018. HBV DNA preC/C amplification. protocols.io dx.doi.org/10.17504/protocols.io.mixc4fn | 2021-03-29 03:09:31 |
Can't find your Protocol?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific protocol and you know the DOI of the protocol already, it's easier to enter a DOI to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your protocol in the search results, please help us by adding it into the system — it's easy. Create and publish your protocols at Protocols.io.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
