Protocols   Select Another Resource Report Type

Authors: Allen Institute for Brain Science
Group: BICCN, Allen Institute for Brain Science
Summary: This protocol is used to produce AAV of any serotype with high purity and high titer.Note: Research reported in this publication was supported by the National Institute Of Mental Health of the National Institutes of Health under Award Number U19MH114830. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Proper citation: Allen Institute for Brain Science 2020. Production of AAV Virus by Iodixanol Gradient Ultracentrifugation. protocols.io https://dx.doi.org/10.17504/protocols.io.bdvxi67n Copy   

•   Source:

Authors: Nancy R. Buchan, Gianluca Grimalda, Marilynn Brewer, Enrique Fatas, Margaret Foddy, Rick Wilson
Summary: We present the protocol of international economics experiments conducted to study the relationship between globalisation, social identity and propensity to cooperate. We developed a scale of individual-level globalisation and three scales of local, social and global social identity. Three experimental decisions in social dilemmas measured the propensity to cooperate at the local, national and global level. Participants were about 200 adults from six countries (the US, Italy, Russia, Argentina, South Africa and Iran).Articles from this research have been published as:- Grimalda G, Buchan N, Brewer M (2018). Social identity mediates the positive effect of globalization on individual cooperation: Results from international experiments. PLoS ONE 13(12): e0206819. https://doi.org/10.1371/journal.pone.0206819. - Buchan N, Brewer M, Grimalda G, Wilson R, Fatas E, Foddy M (2011). “Global Social Identity and Global Cooperation”, Psychological Science, 22(6): 821-828. Doi: 10.1177/0956797611409590. - Buchan N, Grimalda G, Wilson R, Brewer M, Fatas E, Foddy M (2009) “Globalization and Human Cooperation”, Proceedings of the National Academy of Sciences of the USA, 106 (11): 4138-4142. (doi: 10.1073/pnas.0809522106).

Proper citation: Nancy R. Buchan, Gianluca Grimalda, Marilynn Brewer, Enrique Fatas, Margaret Foddy, Rick Wilson 2018. "Globalization, Cooperation & Social Identity" project. protocols.io https://dx.doi.org/10.17504/protocols.io.wmhfc36 Copy   

•   Source:

Authors: Allen Institute for Brain Science
Group: BICCN, Allen Institute for Brain Science
Summary: This protocol describes fragment analyzer operation for polymerase chain reaction (PCR) products. The Fragment Analyzer by Advanced Analytical is used as a quality control step for genotyping PCR products. Peak size, shape, and sample concentration are recorded and used to evaluate samples on a pass/fail level.Note: Research reported in this publication was supported by the National Institute Of Mental Health of the National Institutes of Health under Award Number U19MH114830. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Proper citation: Allen Institute for Brain Science 2020. Fragment Analyzer Operation for PCR Products. protocols.io https://dx.doi.org/10.17504/protocols.io.bg4yjyxw Copy   

•   Source:

Authors: Adriana Alberti, Julie Poulain, Stefan Engelen, Karine Labadie, Sarah Romac, Isabel Ferrera, Guillaume Albini, Jean-Marc Aury, Caroline Belser, Alexis Bertrand, Corinne Cruaud, Corinne Da Silva, Carole Dossat, Frédéric Gavory, Shahinaz Gas, Julie Guy, Maud Haquelle, E'krame Jacoby, Olivier Jaillon, Arnaud Lemainque, Eric Pelletier, Gaëlle Samson, Marc Wessner, Genoscope Technical Team, Silvia G. Acinas, Marta Royo-Llonch, Francisco M. Cornejo-Castillo, Ramiro Logares, Beatriz Fernández-Gómez, Chris Bowler, Guy Cochrane, Clara Amid, Petra Ten Hoopen, Colomban De Vargas, Nigel Grimsley, Elodie Desgranges, Stefanie Kandels-Lewis, Hiroyuki Ogata, Nicole Poulton, Michael E. Sieracki, Ramunas Stepanauskas, Matthew B. Sullivan, Jennifer R. Brum, Melissa B. Duhaime, Bonnie T. Poulos, Bonnie L. Hurwitz, Stéphane Pesant, Eric Karsenti, Patrick Wincker
Group: Tara Oceans
Summary: This protocol describes the sequencing library preparation for the Tara Oceans expedition and is part of Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition. Figure 1: Overview of -omics analysis strategy applied on Tara Oceans samples.

Proper citation: Adriana Alberti, Julie Poulain, Stefan Engelen, Karine Labadie, Sarah Romac, Isabel Ferrera, Guillaume Albini, Jean-Marc Aury, Caroline Belser, Alexis Bertrand, Corinne Cruaud, Corinne Da Silva, Carole Dossat, Frédéric Gavory, Shahinaz Gas, Julie Guy, Maud Haquelle, E'krame Jacoby, Olivier Jaillon, Arnaud Lemainque, Eric Pelletier, Gaëlle Samson, Marc Wessner, Genoscope Technical Team, Silvia G. Acinas, Marta Royo-Llonch, Francisco M. Cornejo-Castillo, Ramiro Logares, Beatriz Fernández-Gómez, Chris Bowler, Guy Cochrane, Clara Amid, Petra Ten Hoopen, Colomban De Vargas, Nigel Grimsley, Elodie Desgranges, Stefanie Kandels-Lewis, Hiroyuki Ogata, Nicole Poulton, Michael E. Sieracki, Ramunas Stepanauskas, Matthew B. Sullivan, Jennifer R. Brum, Melissa B. Duhaime, Bonnie T. Poulos, Bonnie L. Hurwitz, Stéphane Pesant, Eric Karsenti, Patrick Wincker 2020. Sequencing library preparation. protocols.io https://dx.doi.org/10.17504/protocols.io.qwidxce Copy   

•   Source:

Authors: Yaowu Yuan
Group: Mimulus
Summary: This protocol is part of a collection for Mimulus in planta transformation.

Proper citation: Yaowu Yuan 2019. Plant Infiltration for Mimulus in Planta Transformation. protocols.io https://dx.doi.org/10.17504/protocols.io.3rtgm6n Copy   

•   Source:

Authors: Franziska Müller, Memduha Muratoglu, Jana Jung
Summary: Following this protocol, V. Natriegens cells can be transformed with linear fragments and plasmids based on natural transformation as described in Multiplex Genome Editing by Natural Transformation (MuGENT) for Synthetic Biology in Vibrio natriegens Dalia et. al, 2017. ACS Synthetic Biology.

Proper citation: Franziska Müller, Memduha Muratoglu, Jana Jung 2018. Natural Transformation. protocols.io https://dx.doi.org/10.17504/protocols.io.uyzexx6 Copy   

•   Source:

Authors: Alyssa Alsante
Group: The Aquatic Microbial Ecology Research Group - AMERG (The Buchan, Zinser and Wilhelm labs)

Proper citation: Alyssa Alsante 2016. MBBM Media. protocols.io https://dx.doi.org/10.17504/protocols.io.f3dbqi6 Copy   

•   Source:

Authors: Bernardo Pollak
Group: uLoop - Diatom Parts Registry
Summary: Name: pL0R-LacZDescription: a L0 receiver vector which can be used for domestication using SapI-mediated restriction ligation or Gibson assembly. Contains lacZ for blue/white colony screening. Requires X-GAL, IPTG optional depending on E. coli strain.Level 0 Overhangs: Special (cuts into BsaI sites)Length: 2646Antibiotic selection: SpectynomycinOther info: pMB1 oriCharacterisation: ++++ (substantial), works as expected.Primers: AB1U1FCATTACTCGCATCCATTCTC2U1RGAGACGAGACGAGACAGCCT3UXFCCAGGATACATAGATTACCA4UXRGGTGGAAGGGCTCGGAGTTG5L0FTGGGCTGCCTGTATCGAGTG6L0RGCTGGCCTTTTGCTCACA L0 F works great for sequencing.Submitter: Bernardo PollakCloned by: Bernardo PollakAvailability: Upon request at the Pollak/Dupont/Federici labs at the moment and will be available soon from Addgene.

Proper citation: Bernardo Pollak 2019. pL0R-LacZ. protocols.io https://dx.doi.org/10.17504/protocols.io.baa8iahw Copy   

•   Source:

Authors: Adam Hunter
Group: Human Cell Atlas Method Development Community

Proper citation: Adam Hunter 2018. CGAP Human Oesophagus Epithelium Dissociation. protocols.io https://dx.doi.org/10.17504/protocols.io.qz8dx9w Copy   

•   Source:

Authors: Diep Ganguly, Timothy Rhodes, Nay Chi Khin, Estee E Tee, Kai Xun Chan
Group: Pogson Genomics Group
Summary: Protocol for recombinant protein expression in E. coli for protein purification and subsequent enzyme assays, protein crystallography etc.

Proper citation: Diep Ganguly, Timothy Rhodes, Nay Chi Khin, Estee E Tee, Kai Xun Chan 2019. Heterologous protein expression in E. coli. protocols.io https://dx.doi.org/10.17504/protocols.io.95qh85w Copy   

•   Source:

Authors: Johana Rotterova, Ivan Čepička

Proper citation: Johana Rotterova, Ivan Čepička 2019. Transmission electron microscopy protocol for anaerobic ciliates. protocols.io https://dx.doi.org/10.17504/protocols.io.85uhy6w Copy   

•   Source:

Authors: Josh Quick
Group: High molecular weight DNA extraction from all kingdoms, Long Read Club

Proper citation: Josh Quick 2019. The 'Three Peaks' faecal DNA extraction method for long-read sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.584g9yw Copy   

•   Source:

Authors: Jan Pyrih, Julius Lukeš
Summary: A range of recently developed techniques that take advantage of proximity biotinylation, such as BioID, TurboID, and APEX, are particularly suitable for the studies of protein-protein interactions. As compared to classical co-immunoprecipitation, their advantage is higher reproducibility and capacity to identify stable complexes and also capture transient interactions. Briefly, the protein of interest is fused with modified biotin ligase, which promiscuously biotinylates proteins in its proximity. However, until now BioID has been used in T. brucei only in just a handful of studies. Here, we took advantage of the recently developed advanced biotin ligation-based approach named BioID2, which we have successfully adapted for T. brucei. In contrast to the classical BioID technique, BioID2 biotin ligase is smaller (26 kDa), more specific, and attached to the protein of interest by several nm-long linker arm, which improves protein folding and the biotinylation range. When applied to T. brucei, BioID2 labeling produced a highly specific output.

Proper citation: Jan Pyrih, Julius Lukeš 2020. Identification of interacting proteins using proximity-dependent biotinylation with BioID2 in Trypanosoma brucei. protocols.io https://dx.doi.org/10.17504/protocols.io.bdrri556 Copy   

•   Source:

Authors: Ylenia Longo
Group: iGEM Duesseldorf 2018
Summary: This year´s interlab study allows participants to fulfil Bronze medal requirements. For this purposes a set of experiments has to be performed, which in the end will be compared and validated with other team´s data. Part of this Challenge are the Calibration protcols. For the third calibration, a fluorescein standard curve is prepared and fluorescence (bandpass width: 520nm/30nm bandpass, 25-30nm width; excitation; 485nm; emission: 520-530nm) is measured. 

Proper citation: Ylenia Longo 2018. iGEM 2018 Interlab Study Protocol: Calibration 3. protocols.io https://dx.doi.org/10.17504/protocols.io.qpadvie Copy   

•   Source:

Authors: David Dunigan and Irina Agarkova
Group: VERVE Net
Summary: This medium is for growing Chlorella variabilis NC64A, Chlorella heliozoae SAG 3.83, and Coccomyxa C-169.

Proper citation: David Dunigan and Irina Agarkova 2016. Formulation of MBBM (Modified Bold's Basal Medium). protocols.io https://dx.doi.org/10.17504/protocols.io.etwbepe Copy   

•   Source:

Authors: Alexey Zhuravlev, Stepan Orlov, Егор Усик, Alexey Kuzin
Summary: Current protocol is intended to show how to build visualization system which is called ReVisE. Such system is aimed to provide interactive visualization of large datasets hosted on a remote server or a supercomputer. The installation is described for OS Ubuntu.

Proper citation: Alexey Zhuravlev, Stepan Orlov, Егор Усик, Alexey Kuzin 2021. Build ReVisE on Ubuntu . protocols.io https://dx.doi.org/10.17504/protocols.io.bruwm6xe Copy   

•   Source:

Authors: yliu
Group: OnsiteGene 1, XPRIZE Rapid Covid Testing
Summary: This OnsiteGene protocol is designed for testing the normal saliva samples without nucleic acid extraction. A convenient saliva swab is used to collect about 50 μL of saliva for the detection. The protocol uses the Star Array® Hi-SenseTM COVID-19 Molecular Testing Kit 1.0 in the one-step real-time RT-qPCR test assay to qualitatively detect RNA from SARS-CoV-2 virus in the human respiratory specimen. It combines the reverse transcription technology and real-time PCR method to provide accurate detection of the SARS-CoV-2 coronavirus. Along with the Star Array® SATM Direct Extract Buffer, the protocol supports direct amplification without the need of specific RNA extraction equipment and kit. It significantly reduces the loss of RNA from the sample extraction and purification process, saves time and workload from sample preparation, and minimized the burdens on supply chain. The triplex fluorescence design of the kit simultaneously detects the N1 and Orf1ab genes of the virus and the human RNase P gene as an internal control to ensure the sample quality. This protocol uses the Star Array® XDiveTM Superfast Real-Time PCR instrument to perform 40-cycle PCR in 8 minutes, and can test up to 16 samples or controls in each run. The total protocol time from sample collection to data interpretation is less than 11 minutes.The sample collection steps is adapted from the published protocol:https://www.protocols.io/view/salivadirect-rna-extraction-free-sars-cov-2-diagno-bkjgkujw

Proper citation: yliu 2020. OnsiteGene 2 Protocol Saliva Direct. protocols.io https://dx.doi.org/10.17504/protocols.io.bpjgmkjw Copy   

•   Source:

Authors: Jana M. U'Ren, A. Elizabeth Arnold
Group: U'Ren lab - Ecosystem Genomics
Summary: Background InformationHigh throughput amplicon sequencing is an extremely sensitive technique. The lab environment is full of airborne bacterial and fungal cells as well as bacterial and fungal genomic DNA from cultures, and so extreme care must be taken to keep reactions uncontaminated and in preventing cross-contamination.This protocol was modified from the IBEST Geomics Core at University of Idaho.  It utilizes a 2-step PCR, where the first PCR amplifies the specific region of interest (e.g., ITS or 16S V4), and the second PCR adds adapters and barcodes to these amplicons. The target specific primers include (in addition to the standard primer sequence) the universal sequences CS1 and CS2, which provide the bases used in the second PCR to extend the amplicons with Illumina adapters and sample-identification barcodes.Illumina adapters and sample-identification barcodes are not included in the region-specific primers used in PCR1. This allows for maximum flexibility in choosing which primers to use and provides the ability to swap out targets, or include multiple targets in the same sequencing reaction, without needing to purchase a large number of barcoded target specific primers.Barcodes are included in both adapters, therefor a pair of barcodes is used to uniquely identify each sample during bioinformatic processing. This allows us to use 32 barcode pairs to uniquely identify 1024 samples (32 x 32).Phase-shifted primers are used to introduce 1, 2, and/or 3 additional bases to allow for the maximum amount of “sequence diversity” in the first 4 bases. This is important because of how the Illumina sequencers detect clusters on the flowcell during sequencing. If sequences are too similar (as is often the case with amplicons), then sequencing yields will be much lower than expected. 2-bp linkers and phase-shifting bases were chosen to have low identity between primers and the target sequence.Tagged primers were ordered from IDT (standard desalting; not HPLC-purified), re-suspended at 100 μM using a new bottle of molecular grade water in the PCR-free hood, and mixed in equimolar concentration (250 μl each).  Working stocks were diluted to 50 μM for PCR1.

Proper citation: Jana M. U'Ren, A. Elizabeth Arnold 2017. Illumina MiSeq Dual-barcoded Two-step PCR Amplicon Sequencing Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.fs9bnh6 Copy   

•   Source:

Authors: Adriana Alberti, Julie Poulain, Stefan Engelen, Karine Labadie, Sarah Romac, Isabel Ferrera, Guillaume Albini, Jean-Marc Aury, Caroline Belser, Alexis Bertrand, Corinne Cruaud, Corinne Da Silva, Carole Dossat, Frédéric Gavory, Shahinaz Gas, Julie Guy, Maud Haquelle, E'krame Jacoby, Olivier Jaillon, Arnaud Lemainque, Eric Pelletier, Gaëlle Samson, Marc Wessner, Genoscope Technical Team, Silvia G. Acinas, Marta Royo-Llonch, Francisco M. Cornejo-Castillo, Ramiro Logares, Beatriz Fernández-Gómez, Chris Bowler, Guy Cochrane, Clara Amid, Petra Ten Hoopen, Colomban De Vargas, Nigel Grimsley, Elodie Desgranges, Stefanie Kandels-Lewis, Hiroyuki Ogata, Nicole Poulton, Michael E. Sieracki, Ramunas Stepanauskas, Matthew B. Sullivan, Jennifer R. Brum, Melissa B. Duhaime, Bonnie T. Poulos, Bonnie L. Hurwitz, Stéphane Pesant, Eric Karsenti, Patrick Wincker
Group: Tara Oceans
Summary: This protocol is part of Nucleic acids preparations for Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition. 

Proper citation: Adriana Alberti, Julie Poulain, Stefan Engelen, Karine Labadie, Sarah Romac, Isabel Ferrera, Guillaume Albini, Jean-Marc Aury, Caroline Belser, Alexis Bertrand, Corinne Cruaud, Corinne Da Silva, Carole Dossat, Frédéric Gavory, Shahinaz Gas, Julie Guy, Maud Haquelle, E'krame Jacoby, Olivier Jaillon, Arnaud Lemainque, Eric Pelletier, Gaëlle Samson, Marc Wessner, Genoscope Technical Team, Silvia G. Acinas, Marta Royo-Llonch, Francisco M. Cornejo-Castillo, Ramiro Logares, Beatriz Fernández-Gómez, Chris Bowler, Guy Cochrane, Clara Amid, Petra Ten Hoopen, Colomban De Vargas, Nigel Grimsley, Elodie Desgranges, Stefanie Kandels-Lewis, Hiroyuki Ogata, Nicole Poulton, Michael E. Sieracki, Ramunas Stepanauskas, Matthew B. Sullivan, Jennifer R. Brum, Melissa B. Duhaime, Bonnie T. Poulos, Bonnie L. Hurwitz, Stéphane Pesant, Eric Karsenti, Patrick Wincker 2020. DNA and RNA backups. protocols.io https://dx.doi.org/10.17504/protocols.io.qwpdxdn Copy   

•   Source:

Authors: Elizabeth Butterworth, Wesley Dickerson, Vindhya Vijay, Kristina Weitzel, Julia Cooper, Eric W. Atkinson, Jason E. Coleman, Kevin Otto, Martha Campbell Thompson
Group: Human Cell Atlas Method Development Community, Optical Clearing of Tissue, SPARC
Summary: Using traditional histological methods, researchers are hampered in their ability to image whole tissues or organs in large-scale 3D. Histological sections are generally limited to 500 μm using traditional methods. In addition, light scatters from macromolecules within tissues, particularly lipids, prevents imaging to a depth >150 μm with most confocal microscopes. To reduce light scatter and to allow for deep tissue imaging using simple confocal microscopy, various optical clearing methods have been developed that are relevant for rodent and human tissue samples fixed by immersion. Several methods are related and use protein crosslinking with acrylamide and tissue clearing with sodium dodecyl sulfate (SDS). Other optical clearing techniques used various solvents though each modification had various advantages and disadvantages. Here, an optimized passive optical clearing method is described for studies of the human pancreas innervation and specifically for interrogation of the innervation of human islets.

Proper citation: Elizabeth Butterworth, Wesley Dickerson, Vindhya Vijay, Kristina Weitzel, Julia Cooper, Eric W. Atkinson, Jason E. Coleman, Kevin Otto, Martha Campbell Thompson 2020. Human Pancreas PACT Optical Clearing and High Resolution 3D Microscopy. protocols.io https://dx.doi.org/10.17504/protocols.io.9gbh3sn Copy   

•   Source: