Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
LE-Them2-1(cre)Koba Resource Report Resource Website 1+ mentions |
RRID:RGD_598092591 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092591 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092591 | 2026-09-12 01:25:42 | 1 | |||||
|
SD-ROSA26 em1(CAG-DdCBE-Mt-co3, NeuN-Cre/Ilas Resource Report Resource Website 1+ mentions |
RRID:RGD_616336063 | Rattus norvegicus | This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. Rat Resource Center of China (www.ratresource.com) | 616336063 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 616336063 | 2026-09-12 01:25:43 | 1 | |||||
|
LE-Them1(cre)Koba Resource Report Resource Website |
RRID:RGD_598092592 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092592 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092592 | 2026-09-12 01:25:43 | 0 | |||||
|
W-Gpr143em19Gosh Resource Report Resource Website |
RRID:RGD_598092593 | Rattus norvegicus | Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. National BioResource Project for the Rat in Japan | 598092593 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092593 | 2026-09-12 01:25:43 | 0 | |||||
|
SD-ROSA26 em1(CAG-DdCBE-Mt-co3/Ilas Resource Report Resource Website |
RRID:RGD_616335894 | Rattus norvegicus | The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. Rat Resource Center of China (www.ratresource.com) | 616335894 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 616335894 | 2026-09-12 01:25:43 | 0 | |||||
|
SD-C5ar1em22Taoki Resource Report Resource Website |
RRID:RGD_598092525 | Rattus norvegicus | This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA National BioResource Project for the Rat in Japan | 598092525 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-25) | 598092525 | 2026-09-12 01:25:43 | 0 | |||||
|
Slc:WSRC-KitWs Resource Report Resource Website |
RRID:RGD_598092524 | Rattus norvegicus | In 1987, a Ws mutant (RGD:12910762) with a light-colored coat and large abdominal white spots was discovered in a colony of BN/fMai inbred rats that had been allocated to Yagi Memorial Park from the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. However, homozygous for the Ws mutation could not be obtained in BN inbred rats due to embryonic lethality. Therefore, they crossed with Donryu outbred rats and obtained homozygous by crossing F1 heterozygous. This strain was designated as WsRC and was supplied to Japan SLC, Inc. in 1993. National BioResource Project for the Rat in Japan | 598092524 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-03-25) | 598092524 | 2026-09-12 01:25:42 | 0 | |||||
|
SS-Chr3BN.SS-(D3Rat222-D3Mco33)/Mcwi Resource Report Resource Website |
RRID:RGD_155782884 | Rattus norvegicus | SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3.. Contact MCW rat distribution at [email protected] for availability. | 155782884 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 155782884 | 2026-09-12 01:25:42 | 0 | |||||
|
SS-Chr3BN.SS-(D3Rat222-D3Got42)/Mcwi Resource Report Resource Website |
RRID:RGD_155782883 | Rattus norvegicus | SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain) , rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. Contact MCW rat distribution at [email protected] for availability. | 155782883 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 155782883 | 2026-09-12 01:25:42 | 0 | |||||
|
SD-Cyp2dem2(CYP2D6)Kg Resource Report Resource Website |
RRID:RGD_407446371 | Rattus norvegicus | A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. Subsequently, the human CYP2D6 gene (~6.2 kb) was inserted in place of the rat Cyp2d gene cluster. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability. | 407446371 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-29) | 407446371 | 2026-09-12 01:25:42 | 0 | |||||
|
SD-Cyp2dem1Kg Resource Report Resource Website |
RRID:RGD_407446370 | Rattus norvegicus | A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability. | 407446370 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2024-08-29) | 407446370 | 2026-09-12 01:25:42 | 0 | |||||
|
SD-Tg(DNMT3A)-/- Feis Resource Report Resource Website |
RRID:RGD_405849386 | Rattus norvegicus | This is the wild type littermate of the hDNMT3A transgenic rats which were established using zygote microinjection of a bacterial artificial chromosome (BAC). The RP11-159D24 BAC (NCBI-ID:223335, Homo sapiens, GRCh38.p2: Chr. 2: 25,202,642-25,410,145, total length: 207,504 bp) containing DNMT3A (GRCh38.p2: 25,232,961,25,342,590, total length: 109,630 bp) was injected into rat zygotes (Rattus norvegicus, Sprague-Dawley, SD). The offspring were identified with 8 PCR primer-pairs that were specific for the RP11-159D24 sequence to detect positive transgenic ones and wild type littermates that did not carry the human transgene. | 405849386 | transgenic | Rat Genome Database (RGD) | RGD | Unknown | 405849386 | 2026-09-12 01:25:42 | 0 | |||||
|
SHR-Tti2em1Ipcv+/- Resource Report Resource Website |
RRID:RGD_405849381 | Rattus norvegicus | This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls. | 405849381 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405849381 | 2026-09-12 01:25:42 | 0 | |||||
|
WKYLEWF1/Ebv Resource Report Resource Website |
RRID:RGD_407550225 | Rattus norvegicus | This hybrid rat is a cross between a WKY female and a LEW male rat. Department of Physiology, Justus Liebig University, Giessen, Germany | 407550225 | hybrid | Rat Genome Database (RGD) | RGD | Unknown | 407550225 | 2026-09-12 01:25:42 | 0 | |||||
|
SD-Vdrem2Hfd Resource Report Resource Website |
RRID:RGD_408364956 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce deletion and insertion in exon 3 of the VDR gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCccgaccCTGGTGACTTTGACCggaacgtgccccGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCtggt– CTGGTGACTTTGACC------GGATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1034 | 408364956 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2024-11-05) | 408364956 | 2026-09-12 01:25:42 | 0 | |||||
|
F344-ApcPirc/UwmVdrem3Hfd Resource Report Resource Website |
RRID:RGD_408364957 | Rattus norvegicus | The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion. WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1033 | 408364957 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-11-05) | 408364957 | 2026-09-12 01:25:42 | 0 | |||||
|
Wakil:bHRbLRF1 Resource Report Resource Website |
RRID:RGD_529435545 | Rattus norvegicus | Offspring of a cross between the F37 Wakil: bHR (RGD:405847397) female and Wakil bLR (RGD:405847400) male rat. Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 | 529435545 | hybrid | Rat Genome Database (RGD) | RGD | Unknown | 529435545 | 2026-09-12 01:25:42 | 0 | |||||
|
PD Resource Report Resource Website |
RRID:RGD_405878082 | Rattus norvegicus | Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the polydactyly-luxate syndrome. | 405878082 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 405878082 | 2026-09-12 01:25:42 | 0 | |||||
|
Yxch:SD Resource Report Resource Website |
RRID:RGD_401960080 | Rattus norvegicus | Experimental Animal Center of Army Medical University (Chongqing, China). Experimental Animal Center of Army Medical University (Chongqing, China). | 401960080 | outbred | Rat Genome Database (RGD) | RGD | Unknown | 401960080 | 2026-09-12 01:25:42 | 0 | |||||
|
SD-Eml1tish/Scrb Resource Report Resource Website |
RRID:RGD_597538479 | Rattus norvegicus | The first tish animals were identified on the basis of postmortem histological analyses during the course of unrelated experiments using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. A breeding colony was established by identifying living relatives of deceased tish individuals, and then these relatives were screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). University of Virginia, Charlottesville, VA, United States | 597538479 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 597538479 | 2026-09-12 01:25:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
