SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 99 showing 1961 ~ 1980 out of 4,642 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_61100

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61100

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61100
Notes: Strain originated from an inbred SHR strain from Harlan UK Ltd.

Proper citation: RRID:RGD_61100 Copy   


  • RRID:RGD_61105

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61105

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61105
Notes: Derived from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. and maintained at Harlan Indianapolis, Indiana U.S.A. Envigo

Proper citation: RRID:RGD_61105 Copy   


  • RRID:RGD_61014

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61014

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61014
Notes: Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence'

Proper citation: RRID:RGD_61014 Copy   


  • RRID:RGD_10053598

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10053598

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10053598
Notes: Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN

Proper citation: RRID:RGD_10053598 Copy   


  • RRID:RGD_61001

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61001

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61001
Notes: Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.

Proper citation: RRID:RGD_61001 Copy   


  • RRID:RGD_61004

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61004

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61004
Notes: From Wistar outbred stock in 1978.

Proper citation: RRID:RGD_61004 Copy   


  • RRID:RGD_10047085

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10047085

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10047085
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences

Proper citation: RRID:RGD_10047085 Copy   


  • RRID:RGD_61006

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61006

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61006
Notes: Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994).

Proper citation: RRID:RGD_61006 Copy   


  • RRID:RGD_61009

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61009

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 61009
Notes: Unknown. Keil University from O Stark, Charles University, Prague.

Proper citation: RRID:RGD_61009 Copy   


  • RRID:RGD_10054386

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054386

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054386
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054386 Copy   


  • RRID:RGD_68069

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68069

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 68069
Notes: from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980).

Proper citation: RRID:RGD_68069 Copy   


  • RRID:RGD_629521

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629521

Source Database: Rat Genome Database (RGD)
Genetic Background: consomic
Availability: Cryopreserved Sperm
Alternate IDs: 629521
Notes: A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed

Proper citation: RRID:RGD_629521 Copy   


  • RRID:RGD_68070

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68070

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 68070
Notes: Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984)

Proper citation: RRID:RGD_68070 Copy   


  • RRID:RGD_10054383

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054383

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054383
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054383 Copy   


  • RRID:RGD_68072

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68072

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 68072
Notes: from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1

Proper citation: RRID:RGD_68072 Copy   


  • RRID:RGD_68073

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68073

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 68073
Notes: A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan

Proper citation: RRID:RGD_68073 Copy   


  • RRID:RGD_70413

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=70413

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 70413

Proper citation: RRID:RGD_70413 Copy   


  • RRID:RGD_10054398

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054398

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054398
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054398 Copy   


  • RRID:RGD_70411

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=70411

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Synonyms: , Non-Alcohol
Alternate IDs: 70411
Notes: Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure.

Proper citation: RRID:RGD_70411 Copy   


  • RRID:RGD_68058

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68058

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68058
Notes: Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).

Proper citation: RRID:RGD_68058 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X