Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092591
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092591
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092591 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336063
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616336063
Notes: This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. Rat Resource Center of China (www.ratresource.com)
Proper citation: RRID:RGD_616336063 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092592
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092592
Notes: The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092592 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092593
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092593
Notes: Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092593 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616335894
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 616335894
Notes: The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. Rat Resource Center of China (www.ratresource.com)
Proper citation: RRID:RGD_616335894 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092525
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-25)
Alternate IDs: 598092525
Notes: This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092525 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092524
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-25)
Alternate IDs: 598092524
Notes: In 1987, a Ws mutant (RGD:12910762) with a light-colored coat and large abdominal white spots was discovered in a colony of BN/fMai inbred rats that had been allocated to Yagi Memorial Park from the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. However, homozygous for the Ws mutation could not be obtained in BN inbred rats due to embryonic lethality. Therefore, they crossed with Donryu outbred rats and obtained homozygous by crossing F1 heterozygous. This strain was designated as WsRC and was supplied to Japan SLC, Inc. in 1993. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092524 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155782884
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 155782884
Notes: SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3.. Contact MCW rat distribution at [email protected] for availability.
Proper citation: RRID:RGD_155782884 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155782883
Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Availability: Unknown
Alternate IDs: 155782883
Notes: SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain)
, rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. Contact MCW rat distribution at [email protected] for availability.
Proper citation: RRID:RGD_155782883 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407446371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-29)
Alternate IDs: 407446371
Notes: A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. Subsequently, the human CYP2D6 gene (~6.2 kb) was inserted in place of the rat Cyp2d gene cluster. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability.
Proper citation: RRID:RGD_407446371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407446370
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown (as of 2024-08-29)
Alternate IDs: 407446370
Notes: A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability.
Proper citation: RRID:RGD_407446370 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849386
Source Database: Rat Genome Database (RGD)
Genetic Background: transgenic
Availability: Unknown
Alternate IDs: 405849386
Notes: This is the wild type littermate of the hDNMT3A transgenic rats which were established using zygote microinjection of a bacterial artificial chromosome (BAC). The RP11-159D24 BAC (NCBI-ID:223335, Homo sapiens, GRCh38.p2: Chr. 2: 25,202,642-25,410,145, total length: 207,504 bp) containing DNMT3A (GRCh38.p2: 25,232,961,25,342,590, total length: 109,630 bp) was injected into rat zygotes (Rattus norvegicus, Sprague-Dawley, SD). The offspring were identified with 8 PCR primer-pairs that were specific for the RP11-159D24 sequence to detect positive transgenic ones and wild type littermates that did not carry the human transgene.
Proper citation: RRID:RGD_405849386 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849381
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 405849381
Notes: This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls.
Proper citation: RRID:RGD_405849381 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407550225
Source Database: Rat Genome Database (RGD)
Genetic Background: hybrid
Availability: Unknown
Alternate IDs: 407550225
Notes: This hybrid rat is a cross between a WKY female and a LEW male rat. Department of Physiology, Justus Liebig University, Giessen, Germany
Proper citation: RRID:RGD_407550225 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364956
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2024-11-05)
Alternate IDs: 408364956
Notes: The CRISPR/Cas9 system was used to introduce deletion and insertion in exon 3 of the VDR gene of Hsd:SD rat embryos
WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCccgaccCTGGTGACTTTGACCggaacgtgccccGGATCTGTGGAGTGTGTGGAGACCGAGCCAC
KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCtggt– CTGGTGACTTTGACC------GGATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1034
Proper citation: RRID:RGD_408364956 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=408364957
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2024-11-05)
Alternate IDs: 408364957
Notes: The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion.
WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC
KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1033
Proper citation: RRID:RGD_408364957 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=529435545
Source Database: Rat Genome Database (RGD)
Genetic Background: hybrid
Availability: Unknown
Alternate IDs: 529435545
Notes: Offspring of a cross between the F37 Wakil: bHR (RGD:405847397) female and Wakil bLR (RGD:405847400) male rat. Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109
Proper citation: RRID:RGD_529435545 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405878082
Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Unknown
Alternate IDs: 405878082
Notes: Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the polydactyly-luxate syndrome.
Proper citation: RRID:RGD_405878082 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401960080
Source Database: Rat Genome Database (RGD)
Genetic Background: outbred
Availability: Unknown
Alternate IDs: 401960080
Notes: Experimental Animal Center of Army Medical University (Chongqing, China). Experimental Animal Center of Army Medical University (Chongqing, China).
Proper citation: RRID:RGD_401960080 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=597538479
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 597538479
Notes: The first tish animals were identified on the basis of postmortem
histological analyses during the course of unrelated experiments
using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic
gray matter that is located bilaterally beneath the neocortex. Mild to moderate
ventriculomegaly is also observed in most tish animals.
A breeding colony was established by identifying living relatives
of deceased tish individuals, and then these relatives were
screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). University of Virginia, Charlottesville, VA, United States
Proper citation: RRID:RGD_597538479 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
