Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 98 showing 1941 ~ 1960 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00005282

http://www.wormbase.org/db/get?name=WBStrain00005282

Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: available
Source References: EMPTY
Synonyms: eat-4(ky5) III; kyEx844.
Alternate IDs: WB-STRAIN:CX6827, CGC_CX6827
Notes: kyEx844 contains [odr-3::eat-4 + elt-2::GFP].

Proper citation: RRID:WB-STRAIN:WBStrain00005282 Copy   


  • RRID:WB-STRAIN:WBStrain00005278

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005278

Source Database: WormBase (WB)
Affected Genes: WBGene00002141(inx-19)
Genomic Alteration: WBGene00002141(inx-19)
Availability: available
Source References: PMID:38302462
Synonyms: inx-19(ky634) I.
Alternate IDs: WB-STRAIN:CX6161, CGC_CX6161
Notes: Previously called nsy-5.

Proper citation: RRID:WB-STRAIN:WBStrain00005278 Copy   


  • RRID:WB-STRAIN:WBStrain00005210

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005210

Source Database: WormBase (WB)
Affected Genes: WBGene00006749(unc-9)
Genomic Alteration: WBGene00006749(unc-9)
Availability: available
Source References: EMPTY
Synonyms: unc-9(fc16) X.
Alternate IDs: WB-STRAIN:CW129, CGC_CW129
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005210 Copy   


  • RRID:WB-STRAIN:WBStrain00005298

http://www.wormbase.org/db/get?name=WBStrain00005298

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11259
Notes: Isolated_by A. Sivasundar

Proper citation: RRID:WB-STRAIN:WBStrain00005298 Copy   


  • RRID:WB-STRAIN:WBStrain00005211

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005211

Source Database: WormBase (WB)
Affected Genes: WBGene00001520(gas-1)
Genomic Alteration: WBGene00001520(gas-1)
Availability: available
Source References: PMID:9952163, PMID:33542359, PMID:33713125, PMID:33640978, PMID:37957360
Synonyms: gas-1(fc21) X.
Alternate IDs: WB-STRAIN:CW152, CGC_CW152
Notes: Hypersensitive to volatile anesthetics. Temperature sensitive hypomorph and should be propagated at or below 20C. Low brood size.|"Supplementary_genotype gas-1(fc21) X"|"WBStrain mapped, WBPaper00061258 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005211 Copy   


  • RRID:WB-STRAIN:WBStrain00005296

http://www.wormbase.org/db/get?name=WBStrain00005296

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11254
Notes: Isolated_by A. Sivasundar

Proper citation: RRID:WB-STRAIN:WBStrain00005296 Copy   


  • RRID:WB-STRAIN:WBStrain00005294

http://www.wormbase.org/db/get?name=WBStrain00005294

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:19285466, PMID:31422888, PMID:38302462
Synonyms: kyIR1(V, CB4856>N2).
Alternate IDs: WB-STRAIN:CX10774
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005294 Copy   


  • RRID:WB-STRAIN:WBStrain00005293

http://www.wormbase.org/db/get?name=WBStrain00005293

Source Database: WormBase (WB)
Affected Genes: WBGene00007119(calf-1)
Genomic Alteration: WBGene00007119(calf-1)
Availability: available
Source References: PMID:38302462
Synonyms: calf-1(ky867) V.
Alternate IDs: WB-STRAIN:CX10207, CGC_CX10207
Notes: Saheki Y, Bargmann CI. Nat Neurosci. 2009 Oct;12(10):1257-65.

Proper citation: RRID:WB-STRAIN:WBStrain00005293 Copy   


  • RRID:WB-STRAIN:WBStrain00005209

http://www.wormbase.org/db/get?name=WBStrain00005209

Source Database: WormBase (WB)
Affected Genes: WBGene00006811(unc-79)
Genomic Alteration: WBGene00006811(unc-79)
Availability: available
Source References: EMPTY
Synonyms: unc-79(ec1) III.
Alternate IDs: WB-STRAIN:CW16, CGC_CW16
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005209 Copy   


  • RRID:WB-STRAIN:WBStrain00005207

http://www.wormbase.org/db/get?name=WBStrain00005207

Source Database: WormBase (WB)
Affected Genes: WBGene00016630(acer-1)
Genomic Alteration: WBGene00016630(acer-1)
Availability: available
Source References: EMPTY
Synonyms: acer-1(rj15) II.
Alternate IDs: WB-STRAIN:CV385, CGC_CV385
Notes: acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion. Increased histone acetylation. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.

Proper citation: RRID:WB-STRAIN:WBStrain00005207 Copy   


  • RRID:WB-STRAIN:WBStrain00005203

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005203

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019247(syp-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019247(syp-4)
Availability: available
Source References: EMPTY
Synonyms: syp-4(tm2713) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:CV87, CGC_CV87
Notes: Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP syp-4(tm2713) homozygotes (viable but throw 97% dead eggs, 40% males). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2009) PLoS Genet 5(10):e1000669.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00005203 Copy   


  • RRID:WB-STRAIN:WBStrain00005204

http://www.wormbase.org/db/get?name=WBStrain00005204

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00011415(him-18)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00011415(him-18)
Availability: available
Source References: PMID:36176234
Synonyms: him-18(tm2181)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III.
Alternate IDs: WB-STRAIN:CV98, CGC_CV98
Notes: Mutagen:UV/TMP|"qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygous animals show roller phenotype and GFP signal at the distal tip cells. Segregates roller GFP(+) heterozygotes, wild-type moving GFP(-) him-18(tm2181) homozygotes. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygous animals are dead. P0 him-18(tm2181) homozygous animals show 80% embryonic lethality and 12% high incidence of male at F1. Pick roller GFP(+) worms to maintain. Reference: Saito TT, et al. (2009) PLoS Genet 5:e1000735."|"Supplementary_genotype him-18(tm2181)III/qCq dpy-19(e1259)glp-1(q339)nls189 III"

Proper citation: RRID:WB-STRAIN:WBStrain00005204 Copy   


  • RRID:WB-STRAIN:WBStrain00005202

http://www.wormbase.org/db/get?name=WBStrain00005202

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00020068(cra-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020068(cra-1)
Availability: available
Source References: EMPTY
Synonyms: cra-1(tm2144) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:CV78, CGC_CV78
Notes: Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP cra-1(tm2144) homozygotes (99.7% embryonic lethality, 61% larval lethality, Him). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2008) PLoS Genet 4(6):e1000088.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00005202 Copy   


  • RRID:WB-STRAIN:WBStrain00005222

http://www.wormbase.org/db/get?name=WBStrain00005222

Source Database: WormBase (WB)
Affected Genes: WBGene00003849(odr-2)
Genomic Alteration: WBGene00003849(odr-2)
Availability: available
Source References: PMID:8348618, PMID:36652499
Synonyms: odr-2(n2145) V.
Alternate IDs: WB-STRAIN:CX2304, CGC_CX2304
Notes: Defective chemotaxis to some volatile odorants: benzaldehyde, isoamyl alcohol.

Proper citation: RRID:WB-STRAIN:WBStrain00005222 Copy   


  • RRID:WB-STRAIN:WBStrain00005220

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005220

Source Database: WormBase (WB)
Affected Genes: WBGene00003848(odr-1)
Genomic Alteration: WBGene00003848(odr-1)
Availability: available
Source References: PMID:8348618, PMID:21173231, PMID:36652499, PMID:38302462
Synonyms: odr-1(n1936) X.
Alternate IDs: WB-STRAIN:CX2065, CGC_CX2065
Notes: Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]

Proper citation: RRID:WB-STRAIN:WBStrain00005220 Copy   


  • RRID:WB-STRAIN:WBStrain00005218

http://www.wormbase.org/db/get?name=WBStrain00005218

Source Database: WormBase (WB)
Affected Genes: WBGene00000446(ceh-23)|WBGene00000998(dig-1)
Genomic Alteration: WBGene00000446(ceh-23), WBGene00000998(dig-1)
Availability: available
Source References: PMID:10409513
Synonyms: dig-1(ky188) III; kyIs4 X.
Alternate IDs: WB-STRAIN:CX188, CGC_CX188
Notes: kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Proper citation: RRID:WB-STRAIN:WBStrain00005218 Copy   


  • RRID:WB-STRAIN:WBStrain00005219

http://www.wormbase.org/db/get?name=WBStrain00005219

Source Database: WormBase (WB)
Affected Genes: WBGene00006365(syg-1)
Genomic Alteration: WBGene00006365(syg-1)
Availability: available
Source References: PMID:32857970
Synonyms: kyIs235 V; syg-1(ky652) X.
Alternate IDs: WB-STRAIN:CX652, CGC_CX652
Notes: kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005219 Copy   


  • RRID:WB-STRAIN:WBStrain00005216

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005216

Source Database: WormBase (WB)
Affected Genes: WBGene00003856(odr-10)
Genomic Alteration: WBGene00003856(odr-10)
Availability: available
Source References: PMID:8601313, PMID:36652499, PMID:38514005
Synonyms: odr-10(ky32) X
Alternate IDs: WB-STRAIN:CX32, CGC_CX32
Notes: Impaired chemotaxis to low concentrations of the odorant diacetyl.

Proper citation: RRID:WB-STRAIN:WBStrain00005216 Copy   


  • RRID:WB-STRAIN:WBStrain00005217

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005217

Source Database: WormBase (WB)
Affected Genes: WBGene00001130(dyn-1)
Genomic Alteration: WBGene00001130(dyn-1)
Availability: available
Source References: PMID:9294229, PMID:35065714
Synonyms: dyn-1(ky51) X.
Alternate IDs: WB-STRAIN:CX51, CGC_CX51
Notes: ky51 animals are WT (or nearly WT) for locomotion, defecation rate, egg laying and fertility at 15C and 20C. Become Unc within 60 seconds when shifted to 25C. Recover when shifted back to 15C or 20C. dyn-1 encodes a dynamin GTPase. Received new stock from Cori Bargmann Jan 2005.

Proper citation: RRID:WB-STRAIN:WBStrain00005217 Copy   


  • RRID:WB-STRAIN:WBStrain00005215

http://www.wormbase.org/db/get?name=WBStrain00005215

Source Database: WormBase (WB)
Affected Genes: WBGene00000078(adp-1)
Genomic Alteration: WBGene00000078(adp-1)
Availability: available
Source References: PMID:7718242, PMID:38302462
Synonyms: adp-1(ky20) II.
Alternate IDs: WB-STRAIN:CX20, CGC_CX20
Notes: Defective in adaptation to a subset of AWC-sensed odorants. Dominant.|"Made_by: Colbert/Bargmann"

Proper citation: RRID:WB-STRAIN:WBStrain00005215 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X