Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00054711

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi284 I.
Notes: bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.|"Made_by: Michael Martinez"

Proper citation: RRID:WB-STRAIN:WBStrain00054711 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054718

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi327 I.
Notes: bmdSi327 [loxN::ckb-3p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Uterine-specific expression of FLPase in Z1/Z4 and their descendants with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00054718 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054717

Source Database: WormBase (WB)
Affected Genes: WBGene00016200(dpff-1)
Genomic Alteration: WBGene00016200(dpff-1)
Availability: unknown
Source References: EMPTY
Synonyms: dpff-1(bmd302[dpff-1p::^SEC^mNG::AID::DPFF-1]) III.
Notes: Made_by: Yutong Xiao|"Pick Rollers to maintain. Endogenous N-term tagged DPFF-1 with mNG::AID using the self-excising cassette for drug selection. Animals are rollers which contains sqt-1 gene. Remove the SEC for normal expression using the protocol described in Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 2015 Aug;200(4):1035-49. doi: 10.1534/genetics.115.178335. Epub 2015 Jun 3. PMID: 26044593; PMCID: PMC4574250."

Proper citation: RRID:WB-STRAIN:WBStrain00054717 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054719

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi346 I; bmdSi297 II.
Notes: bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00054719 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054663

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: acEx185.
Notes: acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33C, allow them to recover for 12 hours at 20C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.|"Made_by: Jonathan Lalsiamthara"

Proper citation: RRID:WB-STRAIN:WBStrain00054663 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054669

Source Database: WormBase (WB)
Affected Genes: WBGene00019779(endu-2)
Genomic Alteration: WBGene00019779(endu-2)
Availability: unknown
Source References: PMID:37443152
Synonyms: endu-2(tm4977) X; byEx1375.
Notes: byEx1375 [endu-2p::endu-2::eGFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene rescues mortal germline (Mrt) phenotype of endu-2(tm4977). Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

Proper citation: RRID:WB-STRAIN:WBStrain00054669 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054705

Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)
Genomic Alteration: WBGene00006364(syd-2)
Availability: unknown
Source References: EMPTY
Synonyms: syd-2(ju487) X.
Notes: ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.|"Made_by: Ya Dai, Yishi Jin"

Proper citation: RRID:WB-STRAIN:WBStrain00054705 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054704

Source Database: WormBase (WB)
Affected Genes: WBGene00009109(degt-1)
Genomic Alteration: WBGene00009109(degt-1)
Availability: unknown
Source References: EMPTY
Synonyms: muIs32 II; degt-1(ok3307) V.
Notes: Made_by: Eugene Jennifer Jin|"muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]"

Proper citation: RRID:WB-STRAIN:WBStrain00054704 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054666

Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: unknown
Source References: EMPTY
Synonyms: unc-26(pek288[R216Q]) IV.
Notes: Made_by: Sisi Yang|"unc-26(pek288) is a CRISPR-engineered R216Q substitution in unc-26/synaptojanin 1 associated with early-onset Parkinsonism (EOP) (Quadri et al., 2013; Krebs et al., 2013). This allele shows abnormal focal accumulation of ATG-9 in presynaptic nerve terminals, defects in activity-induced synaptic autophagy, and defects in sustained neurotransmission and locomotory behaviors in aging animals. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10. PMID: 35065714"

Proper citation: RRID:WB-STRAIN:WBStrain00054666 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054665

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi577 IV.
Notes: bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.|"Made_by: Itai Toker"

Proper citation: RRID:WB-STRAIN:WBStrain00054665 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054668

Source Database: WormBase (WB)
Affected Genes: WBGene00019779(endu-2)
Genomic Alteration: WBGene00019779(endu-2)
Availability: unknown
Source References: PMID:37443152
Synonyms: endu-2(by190[endu-2::eGFP]) X.
Notes: eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

Proper citation: RRID:WB-STRAIN:WBStrain00054668 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054667

Source Database: WormBase (WB)
Affected Genes: WBGene00018788(shc-1)
Genomic Alteration: WBGene00018788(shc-1)
Availability: unknown
Source References: EMPTY
Synonyms: shc-1(ok198) I; zIs356 IV.
Notes: zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836.

Proper citation: RRID:WB-STRAIN:WBStrain00054667 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054700

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: juIs145 II.
Notes: juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506.

Proper citation: RRID:WB-STRAIN:WBStrain00054700 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054709

Source Database: WormBase (WB)
Affected Genes: WBGene00004076(pod-2)
Genomic Alteration: WBGene00004076(pod-2)
Availability: unknown
Source References: EMPTY
Synonyms: pod-2(tn1765[gfp::3xflag::pod-2]) II.
Notes: Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https:

Proper citation: RRID:WB-STRAIN:WBStrain00054709 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054708

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: lite1(ce314) X; domIs355.
Notes: domIs355 [mec3p::QF + mec4p::QS + QUAS::CoChR::GFP + unc122p::RFP]. High sensitivity blue-light optogenetic line for FLP neurons. Transgenic animals expressing the high-sensitivity blue light-activated channelrhodopsin CoChR into FLP using the Q-system combining mec-3p and mec-4p promoters. In animals grown on all trans-retinal-containing medium, low intensity blue light stimuli trigger reversal responses. Animals have red coelomocytes. The transgene was integrated with UV, and outcrossed 2x to parental ce314 mutant strain KG1180. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242.

Proper citation: RRID:WB-STRAIN:WBStrain00054708 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054651

Source Database: WormBase (WB)
Affected Genes: WBGene00007111(sart-3)
Genomic Alteration: WBGene00007111(sart-3)
Availability: unknown
Source References: EMPTY
Synonyms: sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV.
Notes: Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.

Proper citation: RRID:WB-STRAIN:WBStrain00054651 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054653

Source Database: WormBase (WB)
Affected Genes: WBGene00022048(fln-1)
Genomic Alteration: WBGene00022048(fln-1)
Availability: unknown
Source References: EMPTY
Synonyms: ZK813.1(viz166[fln-1p::ZK813.1]) X.
Notes: Made_by: Jake Seemann|"The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544.doi: 10.1016/j.celrep.2023.112544. PMID: 37227820.."

Proper citation: RRID:WB-STRAIN:WBStrain00054653 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054652

Source Database: WormBase (WB)
Affected Genes: WBGene00007111(sart-3)
Genomic Alteration: WBGene00007111(sart-3)
Availability: unknown
Source References: EMPTY
Synonyms: sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV.
Notes: Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.

Proper citation: RRID:WB-STRAIN:WBStrain00054652 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054654

Source Database: WormBase (WB)
Affected Genes: WBGene00004076(pod-2)|WBGene00004258(pyc-1)|WBGene00009319(mccc-1)|WBGene00017864(pcca-1)
Genomic Alteration: WBGene00004076(pod-2), WBGene00004258(pyc-1), WBGene00009319(mccc-1), WBGene00017864(pcca-1)
Availability: unknown
Source References: EMPTY
Synonyms: pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X.
Notes: Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.

Proper citation: RRID:WB-STRAIN:WBStrain00054654 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054657

Source Database: WormBase (WB)
Affected Genes: WBGene00003407(mrp-1)
Genomic Alteration: WBGene00003407(mrp-1)
Availability: unknown
Source References: EMPTY
Synonyms: mrp-1(pk89) X; acEx174.
Notes: acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.|"Made_by: Jonathan Lalsiamthara"

Proper citation: RRID:WB-STRAIN:WBStrain00054657 Copy   

•   Source: Integrated Animals