Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Species:caenorhabditis elegans (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

62,713 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
bmdSi284 I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054711 Caenorhabditis elegans bmdSi284 I. bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.|"Made_by: Michael Martinez" WB-STRAIN:WBStrain00054711 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
bmdSi327 I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054718 Caenorhabditis elegans bmdSi327 I. bmdSi327 [loxN::ckb-3p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Uterine-specific expression of FLPase in Z1/Z4 and their descendants with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab" WB-STRAIN:WBStrain00054718 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
dpff-1(bmd302[dpff-1p::^SEC^mNG::AID::DPFF-1]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054717 Caenorhabditis elegans dpff-1(bmd302[dpff-1p::^SEC^mNG::AID::DPFF-1]) III. Made_by: Yutong Xiao|"Pick Rollers to maintain. Endogenous N-term tagged DPFF-1 with mNG::AID using the self-excising cassette for drug selection. Animals are rollers which contains sqt-1 gene. Remove the SEC for normal expression using the protocol described in Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 2015 Aug;200(4):1035-49. doi: 10.1534/genetics.115.178335. Epub 2015 Jun 3. PMID: 26044593; PMCID: PMC4574250." WBGene00016200(dpff-1) WBGene00016200(dpff-1) WB-STRAIN:WBStrain00054717 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
bmdSi346 I; bmdSi297 II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054719 Caenorhabditis elegans bmdSi346 I; bmdSi297 II. bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab" WB-STRAIN:WBStrain00054719 WormBase (WB) WB unknown 2026-08-29 09:28:41 0
acEx185.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054663 Caenorhabditis elegans acEx185. acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33C, allow them to recover for 12 hours at 20C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.|"Made_by: Jonathan Lalsiamthara" WB-STRAIN:WBStrain00054663 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
endu-2(tm4977) X; byEx1375.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054669 Caenorhabditis elegans endu-2(tm4977) X; byEx1375. byEx1375 [endu-2p::endu-2::eGFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene rescues mortal germline (Mrt) phenotype of endu-2(tm4977). Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. WBGene00019779(endu-2) WBGene00019779(endu-2) WB-STRAIN:WBStrain00054669 WormBase (WB) WB unknown PMID:37443152 2026-08-29 09:28:39 0
syd-2(ju487) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054705 Caenorhabditis elegans syd-2(ju487) X. ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.|"Made_by: Ya Dai, Yishi Jin" WBGene00006364(syd-2) WBGene00006364(syd-2) WB-STRAIN:WBStrain00054705 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
muIs32 II; degt-1(ok3307) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054704 Caenorhabditis elegans muIs32 II; degt-1(ok3307) V. Made_by: Eugene Jennifer Jin|"muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]" WBGene00009109(degt-1) WBGene00009109(degt-1) WB-STRAIN:WBStrain00054704 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
unc-26(pek288[R216Q]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054666 Caenorhabditis elegans unc-26(pek288[R216Q]) IV. Made_by: Sisi Yang|"unc-26(pek288) is a CRISPR-engineered R216Q substitution in unc-26/synaptojanin 1 associated with early-onset Parkinsonism (EOP) (Quadri et al., 2013; Krebs et al., 2013). This allele shows abnormal focal accumulation of ATG-9 in presynaptic nerve terminals, defects in activity-induced synaptic autophagy, and defects in sustained neurotransmission and locomotory behaviors in aging animals. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10. PMID: 35065714" WBGene00006763(unc-26) WBGene00006763(unc-26) WB-STRAIN:WBStrain00054666 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
bqSi577 IV.
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00054665 Caenorhabditis elegans bqSi577 IV. bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.|"Made_by: Itai Toker" WB-STRAIN:WBStrain00054665 WormBase (WB) WB unknown 2026-08-29 09:28:39 1
endu-2(by190[endu-2::eGFP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054668 Caenorhabditis elegans endu-2(by190[endu-2::eGFP]) X. eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. WBGene00019779(endu-2) WBGene00019779(endu-2) WB-STRAIN:WBStrain00054668 WormBase (WB) WB unknown PMID:37443152 2026-08-29 09:28:39 0
shc-1(ok198) I; zIs356 IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054667 Caenorhabditis elegans shc-1(ok198) I; zIs356 IV. zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836. WBGene00018788(shc-1) WBGene00018788(shc-1) WB-STRAIN:WBStrain00054667 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
juIs145 II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054700 Caenorhabditis elegans juIs145 II. juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506. WB-STRAIN:WBStrain00054700 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
pod-2(tn1765[gfp::3xflag::pod-2]) II.
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00054709 Caenorhabditis elegans pod-2(tn1765[gfp::3xflag::pod-2]) II. Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https: WBGene00004076(pod-2) WBGene00004076(pod-2) WB-STRAIN:WBStrain00054709 WormBase (WB) WB unknown 2026-08-29 09:28:40 1
lite1(ce314) X; domIs355.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054708 Caenorhabditis elegans lite1(ce314) X; domIs355. domIs355 [mec3p::QF + mec4p::QS + QUAS::CoChR::GFP + unc122p::RFP]. High sensitivity blue-light optogenetic line for FLP neurons. Transgenic animals expressing the high-sensitivity blue light-activated channelrhodopsin CoChR into FLP using the Q-system combining mec-3p and mec-4p promoters. In animals grown on all trans-retinal-containing medium, low intensity blue light stimuli trigger reversal responses. Animals have red coelomocytes. The transgene was integrated with UV, and outcrossed 2x to parental ce314 mutant strain KG1180. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242. WB-STRAIN:WBStrain00054708 WormBase (WB) WB unknown 2026-08-29 09:28:40 0
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054651 Caenorhabditis elegans sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. WBGene00007111(sart-3) WBGene00007111(sart-3) WB-STRAIN:WBStrain00054651 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
ZK813.1(viz166[fln-1p::ZK813.1]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054653 Caenorhabditis elegans ZK813.1(viz166[fln-1p::ZK813.1]) X. Made_by: Jake Seemann|"The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544.doi: 10.1016/j.celrep.2023.112544. PMID: 37227820.." WBGene00022048(fln-1) WBGene00022048(fln-1) WB-STRAIN:WBStrain00054653 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054652 Caenorhabditis elegans sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. WBGene00007111(sart-3) WBGene00007111(sart-3) WB-STRAIN:WBStrain00054652 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054654 Caenorhabditis elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. WBGene00004076(pod-2)|WBGene00004258(pyc-1)|WBGene00009319(mccc-1)|WBGene00017864(pcca-1) WBGene00004076(pod-2), WBGene00004258(pyc-1), WBGene00009319(mccc-1), WBGene00017864(pcca-1) WB-STRAIN:WBStrain00054654 WormBase (WB) WB unknown 2026-08-29 09:28:39 0
mrp-1(pk89) X; acEx174.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00054657 Caenorhabditis elegans mrp-1(pk89) X; acEx174. acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.|"Made_by: Jonathan Lalsiamthara" WBGene00003407(mrp-1) WBGene00003407(mrp-1) WB-STRAIN:WBStrain00054657 WormBase (WB) WB unknown 2026-08-29 09:28:39 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.