Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 97 showing 1921 ~ 1940 out of 40,462 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00005226

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005226

Source Database: WormBase (WB)
Affected Genes: WBGene00000446(ceh-23)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00000446(ceh-23), WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Synonyms: kyIs4 lin-15B&lin-15A(n765) X.
Alternate IDs: WB-STRAIN:CX2565, CGC_CX2565
Notes: kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Proper citation: RRID:WB-STRAIN:WBStrain00005226 Copy   

    • RRID:WB-STRAIN:WBStrain00005251

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005251

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Synonyms: kyIs128 lin-15B&lin-15A(n765) X.
Alternate IDs: WB-STRAIN:CX3596, CGC_CX3596
Notes: kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005251 Copy   

    • RRID:WB-STRAIN:WBStrain00005248

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005248

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:37449480, PMID:38421867
Synonyms: lin-15B&lin-15A(n765) kyIs104 X.
Alternate IDs: WB-STRAIN:CX3553, CGC_CX3553
Notes: kyIs104 [str-1p::GFP] X. AWB expression of GFP.|"Made_by: E. Troemel"|"Mutagen:UV/TMP"|"Supplementary_genotype kyIs104 (str-1p::GFP) X; lin-15B&lin-15A(n765)"

Proper citation: RRID:WB-STRAIN:WBStrain00005248 Copy   

    • RRID:WB-STRAIN:WBStrain00005245

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005245

Source Database: WormBase (WB)
Affected Genes: WBGene00003856(odr-10)
Genomic Alteration: WBGene00003856(odr-10)
Availability: available
Source References: PMID:8601313, PMID:34429473, PMID:38302462, PMID:38448519
Synonyms: odr-10(ky225) X.
Alternate IDs: WB-STRAIN:CX3410, CGC_CX3410
Notes: Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids.|"Made_by: Joseph Chou"|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005245 Copy   

    • RRID:WB-STRAIN:WBStrain00005266

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005266

Source Database: WormBase (WB)
Affected Genes: WBGene00003822(nsy-1)|WBGene00006070(str-2)
Genomic Alteration: WBGene00003822(nsy-1), WBGene00006070(str-2)
Availability: available
Source References: PMID:10571181
Synonyms: kyIs140 I; nsy-1(ky397) II.
Alternate IDs: WB-STRAIN:CX4998, CGC_CX4998
Notes: kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons.

Proper citation: RRID:WB-STRAIN:WBStrain00005266 Copy   

    • RRID:WB-STRAIN:WBStrain00005264

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005264

Source Database: WormBase (WB)
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
Source References: PMID:38302462, PMID:38396085
Synonyms: ocr-2(ak47) IV.
Alternate IDs: WB-STRAIN:CX4544, CGC_CX4544
Notes: Chemosensory, mechanosensory, and osmosensory defects. Null allele. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005264 Copy   

    • RRID:WB-STRAIN:WBStrain00005277

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005277

Source Database: WormBase (WB)
Availability: available
Source References: PMID:32857970, PMID:37603562
Synonyms: kyIs262 IV.
Alternate IDs: WB-STRAIN:CX5974, CGC_CX5974
Notes: kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV.|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005277 Copy   

    • RRID:WB-STRAIN:WBStrain00005278

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005278

Source Database: WormBase (WB)
Affected Genes: WBGene00002141(inx-19)
Genomic Alteration: WBGene00002141(inx-19)
Availability: available
Source References: PMID:38302462
Synonyms: inx-19(ky634) I.
Alternate IDs: WB-STRAIN:CX6161, CGC_CX6161
Notes: Previously called nsy-5.

Proper citation: RRID:WB-STRAIN:WBStrain00005278 Copy   

    • RRID:WB-STRAIN:WBStrain00005210

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005210

Source Database: WormBase (WB)
Affected Genes: WBGene00006749(unc-9)
Genomic Alteration: WBGene00006749(unc-9)
Availability: available
Synonyms: unc-9(fc16) X.
Alternate IDs: WB-STRAIN:CW129, CGC_CW129
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005210 Copy   

    • RRID:WB-STRAIN:WBStrain00005211

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005211

Source Database: WormBase (WB)
Affected Genes: WBGene00001520(gas-1)
Genomic Alteration: WBGene00001520(gas-1)
Availability: available
Source References: PMID:9952163, PMID:33542359, PMID:33713125, PMID:33640978, PMID:37957360
Synonyms: gas-1(fc21) X.
Alternate IDs: WB-STRAIN:CW152, CGC_CW152
Notes: Hypersensitive to volatile anesthetics. Temperature sensitive hypomorph and should be propagated at or below 20C. Low brood size.|"Supplementary_genotype gas-1(fc21) X"|"WBStrain mapped, WBPaper00061258 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005211 Copy   

    • RRID:WB-STRAIN:WBStrain00005203

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005203

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00019247(syp-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00019247(syp-4)
Availability: available
Synonyms: syp-4(tm2713) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:CV87, CGC_CV87
Notes: Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP syp-4(tm2713) homozygotes (viable but throw 97% dead eggs, 40% males). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2009) PLoS Genet 5(10):e1000669.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00005203 Copy   

    • RRID:WB-STRAIN:WBStrain00005220

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005220

Source Database: WormBase (WB)
Affected Genes: WBGene00003848(odr-1)
Genomic Alteration: WBGene00003848(odr-1)
Availability: available
Source References: PMID:8348618, PMID:21173231, PMID:36652499, PMID:38302462
Synonyms: odr-1(n1936) X.
Alternate IDs: WB-STRAIN:CX2065, CGC_CX2065
Notes: Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]

Proper citation: RRID:WB-STRAIN:WBStrain00005220 Copy   

    • RRID:WB-STRAIN:WBStrain00005216

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005216

Source Database: WormBase (WB)
Affected Genes: WBGene00003856(odr-10)
Genomic Alteration: WBGene00003856(odr-10)
Availability: available
Source References: PMID:8601313, PMID:36652499, PMID:38514005
Synonyms: odr-10(ky32) X
Alternate IDs: WB-STRAIN:CX32, CGC_CX32
Notes: Impaired chemotaxis to low concentrations of the odorant diacetyl.

Proper citation: RRID:WB-STRAIN:WBStrain00005216 Copy   

    • RRID:WB-STRAIN:WBStrain00005217

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005217

Source Database: WormBase (WB)
Affected Genes: WBGene00001130(dyn-1)
Genomic Alteration: WBGene00001130(dyn-1)
Availability: available
Source References: PMID:9294229, PMID:35065714
Synonyms: dyn-1(ky51) X.
Alternate IDs: WB-STRAIN:CX51, CGC_CX51
Notes: ky51 animals are WT (or nearly WT) for locomotion, defecation rate, egg laying and fertility at 15C and 20C. Become Unc within 60 seconds when shifted to 25C. Recover when shifted back to 15C or 20C. dyn-1 encodes a dynamin GTPase. Received new stock from Cori Bargmann Jan 2005.

Proper citation: RRID:WB-STRAIN:WBStrain00005217 Copy   

    • RRID:WB-STRAIN:WBStrain00005213

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005213

Source Database: WormBase (WB)
Affected Genes: WBGene00003854(odr-7)
Genomic Alteration: WBGene00003854(odr-7)
Availability: available
Source References: PMID:8001144, PMID:37258276, PMID:38421867, PMID:38448519
Synonyms: odr-7(ky4) X.
Alternate IDs: WB-STRAIN:CX4, CGC_CX4
Notes: odr-7 mutants fail to respond to odorants sensed by the AWA neurons.|"Supplementary_genotype odr-7(ky04)"

Proper citation: RRID:WB-STRAIN:WBStrain00005213 Copy   

    • RRID:WB-STRAIN:WBStrain00005354

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005354

Source Database: WormBase (WB)
Affected Genes: WBGene00000042(acr-2)
Genomic Alteration: WBGene00000042(acr-2)
Availability: available
Source References: PMID:37416472, PMID:38421866
Synonyms: juIs14 IV.
Alternate IDs: WB-STRAIN:CZ631, CGC_CZ631
Notes: juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52.

Proper citation: RRID:WB-STRAIN:WBStrain00005354 Copy   

    • RRID:WB-STRAIN:WBStrain00005351

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005351

Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Synonyms: vab-1(ju8) II.
Alternate IDs: WB-STRAIN:CZ429, CGC_CZ429
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005351 Copy   

    • RRID:WB-STRAIN:WBStrain00005349

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005349

Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: PMID:9506518
Synonyms: vab-1(e699) II.
Alternate IDs: WB-STRAIN:CZ414, CGC_CZ414
Notes: Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414.

Proper citation: RRID:WB-STRAIN:WBStrain00005349 Copy   

    • RRID:WB-STRAIN:WBStrain00005346

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005346

Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: PMID:9506518, PMID:36975724
Synonyms: vab-1(dx31) II.
Alternate IDs: WB-STRAIN:CZ337, CGC_CZ337
Notes: Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null.

Proper citation: RRID:WB-STRAIN:WBStrain00005346 Copy   

    • RRID:WB-STRAIN:WBStrain00005347

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005347

Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Synonyms: vab-1(e856) II.
Alternate IDs: WB-STRAIN:CZ375, CGC_CZ375
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00005347 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

dkNET community events and announcements in October, 2026

Test 10092026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch