Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00054732

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:39259762
Synonyms: rhIs2.
Notes: rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5UTR and 1 kb 3 UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.

Proper citation: RRID:WB-STRAIN:WBStrain00054732 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054731

Source Database: WormBase (WB)
Affected Genes: WBGene00018976(daam-1)
Genomic Alteration: WBGene00018976(daam-1)
Availability: unknown
Source References: EMPTY
Synonyms: daam-1(ups39) V.
Notes: Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.

Proper citation: RRID:WB-STRAIN:WBStrain00054731 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054734

Source Database: WormBase (WB)
Affected Genes: WBGene00001086(dpy-27)
Genomic Alteration: WBGene00001086(dpy-27)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi57 II; ers54[dpy-27::degron::GFP] III.
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.|"Made_by: Ana Morao"

Proper citation: RRID:WB-STRAIN:WBStrain00054734 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054684

Source Database: WormBase (WB)
Affected Genes: WBGene00001423(fib-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001423(fib-1), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V.
Notes: muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054684 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054686

Source Database: WormBase (WB)
Affected Genes: WBGene00001423(fib-1)
Genomic Alteration: WBGene00001423(fib-1)
Availability: unknown
Source References: PMID:39652010
Synonyms: muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V.
Notes: muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054686 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054685

Source Database: WormBase (WB)
Affected Genes: WBGene00001877(his-3)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001877(his-3), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V.
Notes: muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054685 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054680

Source Database: WormBase (WB)
Affected Genes: WBGene00003230(mex-5)|WBGene00004896(smu-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00003230(mex-5), WBGene00004896(smu-2), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III.
Notes: Made_by: Dmytro Kukhtar|"Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4."

Proper citation: RRID:WB-STRAIN:WBStrain00054680 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054681

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00013025(vha-13)
Genomic Alteration: WBGene00006843(unc-119), WBGene00013025(vha-13)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V.
Notes: muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Proper citation: RRID:WB-STRAIN:WBStrain00054681 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054724

Source Database: WormBase (WB)
Affected Genes: WBGene00001207(egl-43)
Genomic Alteration: WBGene00001207(egl-43)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II.
Notes: bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Yutong Xiao"

Proper citation: RRID:WB-STRAIN:WBStrain00054724 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054727

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi245 swsn-8(bmd222[(swsn-8p::swsn-8::GFP]) I.
Notes: bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Yutong Xiao"

Proper citation: RRID:WB-STRAIN:WBStrain00054727 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054723

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi348 I; bmdSi362 II.
Notes: bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi362 [loxN::rpl-28p::FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in neurons. High levels of TIR1(F79G) expression in neurons by rgef-1p::FLP with co-expression of membrane markers. bmdSi362 contains the ubiquitous rpl-28 promoter driving expression of FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2 construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00054723 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054729

Source Database: WormBase (WB)
Affected Genes: WBGene00004055(pmk-1)
Genomic Alteration: WBGene00004055(pmk-1)
Availability: unknown
Source References: EMPTY
Synonyms: pmk-1(re170[pmk-1::mNG::3xFlag]) IV.
Notes: Made_by: Hanna Shin|"mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501"

Proper citation: RRID:WB-STRAIN:WBStrain00054729 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054673

Source Database: WormBase (WB)
Affected Genes: WBGene00006724(ubh-4)
Genomic Alteration: WBGene00006724(ubh-4)
Availability: unknown
Source References: EMPTY
Synonyms: ubh-4(cer25[F73V]) II.
Notes: Made_by: Carmen Martnez-Fernndez|"Superficially wild-type. ubh-4(cer25[F73V]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270"

Proper citation: RRID:WB-STRAIN:WBStrain00054673 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054674

Source Database: WormBase (WB)
Affected Genes: WBGene00006724(ubh-4)
Genomic Alteration: WBGene00006724(ubh-4)
Availability: unknown
Source References: EMPTY
Synonyms: ubh-4(cer27) II.
Notes: Made_by: Carmen Martnez-Fernndez|"Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270"

Proper citation: RRID:WB-STRAIN:WBStrain00054674 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054670

Source Database: WormBase (WB)
Affected Genes: WBGene00019779(endu-2)
Genomic Alteration: WBGene00019779(endu-2)
Availability: unknown
Source References: PMID:37443152
Synonyms: endu-2(tm4977) X; byEx1551.
Notes: byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

Proper citation: RRID:WB-STRAIN:WBStrain00054670 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054714

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi297 II.
Notes: bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. Ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00054714 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054713

Source Database: WormBase (WB)
Affected Genes: WBGene00001834(hda-1)
Genomic Alteration: WBGene00001834(hda-1)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi245 I; hda-1(bmd134[HDA-1::GFP::loxP]) V.
Notes: bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Yutong Xiao"

Proper citation: RRID:WB-STRAIN:WBStrain00054713 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054676

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004465(rpn-9)|WBGene00006724(ubh-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004465(rpn-9), WBGene00006724(ubh-4)
Availability: unknown
Source References: EMPTY
Synonyms: ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II.
Notes: Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270|"Made_by: Carmen Martnez-Fernndez"

Proper citation: RRID:WB-STRAIN:WBStrain00054676 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054712

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bmdSi282.
Notes: bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Taylor N. Medwig-Kinney"

Proper citation: RRID:WB-STRAIN:WBStrain00054712 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054678

Source Database: WormBase (WB)
Affected Genes: WBGene00000296(cat-2)
Genomic Alteration: WBGene00000296(cat-2)
Availability: unknown
Source References: EMPTY
Synonyms: cat-2(cer181[cat-2p::GFP::H2B 1-3]) II.
Notes: Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martnez-Fernndez C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130|"Made_by: Carmen Martnez-Fernndez"

Proper citation: RRID:WB-STRAIN:WBStrain00054678 Copy   

•   Source: Integrated Animals